Incidental Mutation 'R2046:Nrm'
ID222033
Institutional Source Beutler Lab
Gene Symbol Nrm
Ensembl Gene ENSMUSG00000059791
Gene Namenurim (nuclear envelope membrane protein)
Synonyms2610307M02Rik
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35861318-35865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35864217 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 146 (V146I)
Ref Sequence ENSEMBL: ENSMUSP00000073873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000082337] [ENSMUST00000113814] [ENSMUST00000122899] [ENSMUST00000127442] [ENSMUST00000144382] [ENSMUST00000174873] [ENSMUST00000187690] [ENSMUST00000190496]
Predicted Effect probably benign
Transcript: ENSMUST00000074259
AA Change: V146I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791
AA Change: V146I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113814
SMART Domains Protein: ENSMUSP00000109445
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122899
SMART Domains Protein: ENSMUSP00000120343
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127442
SMART Domains Protein: ENSMUSP00000115753
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 27 117 1.5e-39 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 540 6.9e-34 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144382
SMART Domains Protein: ENSMUSP00000116100
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect unknown
Transcript: ENSMUST00000172931
AA Change: V46I
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791
AA Change: V46I

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174873
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184224
Predicted Effect probably benign
Transcript: ENSMUST00000187690
SMART Domains Protein: ENSMUSP00000141094
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190496
SMART Domains Protein: ENSMUSP00000140652
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin 1 113 3.6e-43 PFAM
low complexity region 132 145 N/A INTRINSIC
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in Nrm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Nrm APN 17 35864755 missense probably benign 0.06
IGL02511:Nrm APN 17 35861424 missense probably damaging 1.00
R0211:Nrm UTSW 17 35864611 missense probably damaging 1.00
R0557:Nrm UTSW 17 35864632 missense probably damaging 1.00
R0602:Nrm UTSW 17 35864264 nonsense probably null
R0635:Nrm UTSW 17 35864264 nonsense probably null
R1571:Nrm UTSW 17 35864187 missense probably damaging 1.00
R4073:Nrm UTSW 17 35861532 splice site probably benign
R4612:Nrm UTSW 17 35863529 missense probably benign 0.00
R4828:Nrm UTSW 17 35864190 missense possibly damaging 0.72
R6038:Nrm UTSW 17 35861505 missense possibly damaging 0.83
R6322:Nrm UTSW 17 35864713 missense possibly damaging 0.73
R6456:Nrm UTSW 17 35865400 splice site probably null
R7345:Nrm UTSW 17 35864584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCATCTTCATGTCCTTG -3'
(R):5'- TCCTTTAAGGCAAGCTGGAGG -3'

Sequencing Primer
(F):5'- TATACCTGTCGGAAAGAGTCCTCG -3'
(R):5'- CCTTTAAGGCAAGCTGGAGGAAAAC -3'
Posted On2014-08-25