Mutagenetix > Incidental Mutations

Incidental Mutation 'R1978:Inpp5j'

222040

Institutional Source

Beutler Lab

Gene Symbol

Inpp5j

Ensembl Gene

ENSMUSG00000034570

Gene Name

inositol polyphosphate 5-phosphatase J

Synonyms

Pipp, Pib5pa

MMRRC Submission

039991-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3494375-3504821 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3502150 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 367 (P367S)

Ref Sequence

ENSEMBL: ENSMUSP00000139302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044507
AA Change: P367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570
AA Change: P367S

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
low complexity region	115	131	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	180	216	N/A	INTRINSIC
low complexity region	292	311	N/A	INTRINSIC
low complexity region	333	365	N/A	INTRINSIC
low complexity region	390	413	N/A	INTRINSIC
IPPc	418	733	4.41e-98	SMART
low complexity region	840	862	N/A	INTRINSIC
low complexity region	868	887	N/A	INTRINSIC
low complexity region	898	919	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	992	1002	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000044682

SMART Domains

Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
PA2c	139	259	1.58e-2	SMART
low complexity region	305	324	N/A	INTRINSIC
Pfam:Phospholip_A2_2	343	431	4e-9	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000110018
AA Change: P57L

SMART Domains

Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570
AA Change: P57L

Domain	Start	End	E-Value	Type
IPPc	2	301	4e-86	SMART
low complexity region	408	430	N/A	INTRINSIC
low complexity region	436	455	N/A	INTRINSIC
low complexity region	466	487	N/A	INTRINSIC
low complexity region	492	511	N/A	INTRINSIC
low complexity region	560	570	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110019

SMART Domains

Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

Domain	Start	End	E-Value	Type
IPPc	2	301	4e-86	SMART
low complexity region	408	430	N/A	INTRINSIC
low complexity region	436	455	N/A	INTRINSIC
low complexity region	466	487	N/A	INTRINSIC
low complexity region	492	511	N/A	INTRINSIC
low complexity region	560	570	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148939

Predicted Effect

probably damaging
Transcript: ENSMUST00000154756
AA Change: P367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570
AA Change: P367S

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
low complexity region	115	131	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	180	216	N/A	INTRINSIC
low complexity region	292	311	N/A	INTRINSIC
low complexity region	333	365	N/A	INTRINSIC
low complexity region	390	413	N/A	INTRINSIC
IPPc	418	733	4.41e-98	SMART
low complexity region	870	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183684

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably damaging	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Bsn	A	G	9: 108,114,549	S1335P	probably benign	Het
Cep192	T	C	18: 67,803,158		probably null	Het
Cfap57	A	G	4: 118,593,132	S598P	probably benign	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Stag1	T	G	9: 100,888,086	I603S	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttc37	T	C	13: 76,134,815	V752A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Inpp5j

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Inpp5j	APN	11	3500009	splice site	probably benign
IGL00435:Inpp5j	APN	11	3502255	missense	probably benign	0.00
IGL00509:Inpp5j	APN	11	3501595	missense	possibly damaging	0.94
IGL00916:Inpp5j	APN	11	3502389	missense	probably damaging	1.00
IGL00975:Inpp5j	APN	11	3502176	missense	probably damaging	1.00
IGL01523:Inpp5j	APN	11	3495932	splice site	probably null
IGL02472:Inpp5j	APN	11	3495338	unclassified	probably benign
IGL02512:Inpp5j	APN	11	3499661	missense	probably damaging	1.00
IGL02897:Inpp5j	APN	11	3500619	missense	probably damaging	1.00
IGL03408:Inpp5j	APN	11	3502809	missense	possibly damaging	0.95
R0048:Inpp5j	UTSW	11	3501417	missense	probably damaging	0.97
R0440:Inpp5j	UTSW	11	3501150	missense	possibly damaging	0.95
R0455:Inpp5j	UTSW	11	3503122	missense	possibly damaging	0.66
R0483:Inpp5j	UTSW	11	3499738	missense	probably damaging	1.00
R0554:Inpp5j	UTSW	11	3499644	missense	probably damaging	1.00
R0639:Inpp5j	UTSW	11	3501147	missense	probably benign	0.29
R0673:Inpp5j	UTSW	11	3501147	missense	probably benign	0.29
R0926:Inpp5j	UTSW	11	3501439	splice site	probably benign
R1114:Inpp5j	UTSW	11	3494814	missense	possibly damaging	0.57
R1132:Inpp5j	UTSW	11	3502305	missense	possibly damaging	0.90
R1463:Inpp5j	UTSW	11	3501147	missense	probably benign	0.03
R1757:Inpp5j	UTSW	11	3504738	missense	possibly damaging	0.49
R3078:Inpp5j	UTSW	11	3503124	splice site	probably null
R3831:Inpp5j	UTSW	11	3500229	missense	probably damaging	1.00
R4012:Inpp5j	UTSW	11	3500185	missense	probably benign	0.06
R4183:Inpp5j	UTSW	11	3501134	missense	probably damaging	0.99
R4209:Inpp5j	UTSW	11	3501107	missense	probably damaging	1.00
R4210:Inpp5j	UTSW	11	3501107	missense	probably damaging	1.00
R4211:Inpp5j	UTSW	11	3501107	missense	probably damaging	1.00
R4477:Inpp5j	UTSW	11	3501625	missense	probably damaging	1.00
R4729:Inpp5j	UTSW	11	3495025	missense	probably damaging	0.99
R4840:Inpp5j	UTSW	11	3499676	missense	probably damaging	1.00
R5025:Inpp5j	UTSW	11	3500664	missense	probably damaging	1.00
R5151:Inpp5j	UTSW	11	3502270	missense	probably damaging	1.00
R5195:Inpp5j	UTSW	11	3499889	critical splice donor site	probably null
R5623:Inpp5j	UTSW	11	3494766	missense	probably damaging	0.96
R6262:Inpp5j	UTSW	11	3502615	missense	probably benign	0.02
R6448:Inpp5j	UTSW	11	3495387	missense	probably damaging	0.99
R6465:Inpp5j	UTSW	11	3502293	missense	possibly damaging	0.84
R6723:Inpp5j	UTSW	11	3500640	missense	probably damaging	0.99
R6895:Inpp5j	UTSW	11	3495557	splice site	probably null
R7060:Inpp5j	UTSW	11	3500133	splice site	probably null
R7346:Inpp5j	UTSW	11	3501065	missense	probably damaging	1.00
R8026:Inpp5j	UTSW	11	3495171	missense
R8360:Inpp5j	UTSW	11	3499767	missense	probably damaging	0.99
T0975:Inpp5j	UTSW	11	3502527	missense	possibly damaging	0.69
Z1176:Inpp5j	UTSW	11	3502484	nonsense	probably null
Z1177:Inpp5j	UTSW	11	3502191	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATCTCACCGGAATCCAGG -3'
(R):5'- CAAGCTTTCTCAGACCCTCG -3'

Sequencing Primer
(F):5'- CAGGGTCGCTCTTGCAAGTAG -3'
(R):5'- AGACCCTGCCCTTGGATGTG -3'

Posted On

2014-08-25