Mutagenetix > Incidental Mutations

Incidental Mutation 'R1978:Ttc37'

222058

Institutional Source

Beutler Lab

Gene Symbol

Ttc37

Ensembl Gene

ENSMUSG00000033991

Gene Name

tetratricopeptide repeat domain 37

Synonyms

MMRRC Submission

039991-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76098734-76190316 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76134815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 752 (V752A)

Ref Sequence

ENSEMBL: ENSMUSP00000153521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]

AlphaFold

F8VPK0

Predicted Effect

probably benign
Transcript: ENSMUST00000091466
AA Change: V752A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: V752A

Domain	Start	End	E-Value	Type
TPR	6	39	2.92e1	SMART
TPR	40	73	1.1e-1	SMART
TPR	272	305	9.45e0	SMART
TPR	306	339	8.9e-2	SMART
SEL1	420	451	1.45e2	SMART
TPR	420	453	2.55e-2	SMART
SEL1	454	490	1.15e1	SMART
TPR	454	492	2.84e1	SMART
TPR	493	527	1.92e1	SMART
TPR	564	597	7.34e-3	SMART
TPR	598	631	1.81e-2	SMART
TPR	632	665	2.43e1	SMART
low complexity region	728	739	N/A	INTRINSIC
SEL1	861	892	3.58e1	SMART
TPR	861	894	2.14e-4	SMART
TPR	980	1013	1.56e1	SMART
Blast:TPR	1051	1084	7e-11	BLAST
Blast:TPR	1088	1121	7e-10	BLAST
TPR	1399	1432	4.31e0	SMART
low complexity region	1438	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224386
AA Change: V752A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224914

Predicted Effect

probably benign
Transcript: ENSMUST00000225220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225341

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Bsn	A	G	9: 108,114,549	S1335P	probably benign	Het
Cep192	T	C	18: 67,803,158		probably null	Het
Cfap57	A	G	4: 118,593,132	S598P	probably benign	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Inpp5j	G	A	11: 3,502,150	P367S	probably damaging	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Stag1	T	G	9: 100,888,086	I603S	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Ttc37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ttc37	APN	13	76143278	critical splice donor site	probably null
IGL00650:Ttc37	APN	13	76127507	missense	possibly damaging	0.89
IGL00838:Ttc37	APN	13	76134791	missense	probably damaging	0.99
IGL00958:Ttc37	APN	13	76122745	missense	probably damaging	0.98
IGL01011:Ttc37	APN	13	76122665	missense	probably damaging	0.97
IGL01062:Ttc37	APN	13	76155462	nonsense	probably null
IGL01319:Ttc37	APN	13	76129379	missense	probably benign	0.29
IGL01697:Ttc37	APN	13	76128733	missense	probably benign	0.01
IGL02061:Ttc37	APN	13	76129541	critical splice donor site	probably null
IGL02184:Ttc37	APN	13	76111691	missense	probably damaging	1.00
IGL02309:Ttc37	APN	13	76127047	missense	possibly damaging	0.90
IGL03230:Ttc37	APN	13	76155647	splice site	probably benign
IGL03354:Ttc37	APN	13	76182822	missense	possibly damaging	0.71
caviar	UTSW	13	76147767	missense	possibly damaging	0.54
gourmet	UTSW	13	76150519	missense	probably damaging	1.00
tartare	UTSW	13	76185179	missense	probably damaging	0.96
R0501:Ttc37	UTSW	13	76147806	missense	probably benign
R0628:Ttc37	UTSW	13	76150729	missense	possibly damaging	0.89
R0711:Ttc37	UTSW	13	76182891	missense	probably damaging	1.00
R0928:Ttc37	UTSW	13	76113592	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1524:Ttc37	UTSW	13	76138372	missense	probably benign	0.01
R1628:Ttc37	UTSW	13	76111791	missense	possibly damaging	0.75
R1702:Ttc37	UTSW	13	76122743	missense	possibly damaging	0.66
R1750:Ttc37	UTSW	13	76140601	missense	possibly damaging	0.89
R1822:Ttc37	UTSW	13	76130288	missense	probably benign	0.35
R1885:Ttc37	UTSW	13	76113047	missense	probably benign	0.00
R1885:Ttc37	UTSW	13	76130235	missense	probably benign	0.11
R1923:Ttc37	UTSW	13	76134770	missense	probably damaging	1.00
R2040:Ttc37	UTSW	13	76180103	missense	probably damaging	1.00
R2136:Ttc37	UTSW	13	76173354	missense	possibly damaging	0.87
R2268:Ttc37	UTSW	13	76112274	unclassified	probably benign
R2483:Ttc37	UTSW	13	76182867	missense	probably damaging	1.00
R2988:Ttc37	UTSW	13	76155689	missense	probably benign	0.11
R3701:Ttc37	UTSW	13	76113679	missense	probably benign
R3951:Ttc37	UTSW	13	76130219	missense	probably damaging	1.00
R4405:Ttc37	UTSW	13	76155665	missense	probably damaging	0.97
R4411:Ttc37	UTSW	13	76127504	missense	possibly damaging	0.89
R4957:Ttc37	UTSW	13	76185113	splice site	probably null
R4960:Ttc37	UTSW	13	76185156	missense	possibly damaging	0.95
R4993:Ttc37	UTSW	13	76182936	missense	probably damaging	0.96
R5206:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5208:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5302:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5305:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5306:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5579:Ttc37	UTSW	13	76185200	missense	probably damaging	1.00
R5618:Ttc37	UTSW	13	76173426	missense	probably benign
R5726:Ttc37	UTSW	13	76118347	missense	probably damaging	1.00
R5813:Ttc37	UTSW	13	76155733	missense	probably benign	0.05
R5899:Ttc37	UTSW	13	76111819	splice site	probably null
R6146:Ttc37	UTSW	13	76185240	missense	probably damaging	1.00
R6224:Ttc37	UTSW	13	76118291	missense	probably benign	0.02
R6286:Ttc37	UTSW	13	76143240	missense	probably damaging	1.00
R6402:Ttc37	UTSW	13	76135270	missense	probably benign	0.05
R6561:Ttc37	UTSW	13	76150519	missense	probably damaging	1.00
R6808:Ttc37	UTSW	13	76185179	missense	probably damaging	0.96
R7054:Ttc37	UTSW	13	76134960	missense	probably damaging	1.00
R7261:Ttc37	UTSW	13	76113579	missense	probably benign	0.30
R7267:Ttc37	UTSW	13	76180077	missense	probably benign	0.15
R7348:Ttc37	UTSW	13	76182884	missense	possibly damaging	0.82
R7384:Ttc37	UTSW	13	76150735	missense	possibly damaging	0.53
R7404:Ttc37	UTSW	13	76148747	nonsense	probably null
R7421:Ttc37	UTSW	13	76148825	missense	probably benign	0.12
R7546:Ttc37	UTSW	13	76134835	missense	probably damaging	1.00
R7771:Ttc37	UTSW	13	76135030	missense	probably benign	0.21
R7960:Ttc37	UTSW	13	76112199	missense	probably benign	0.03
R8125:Ttc37	UTSW	13	76130327	critical splice donor site	probably null
R8136:Ttc37	UTSW	13	76113103	missense	probably benign	0.00
R8680:Ttc37	UTSW	13	76155468	missense	probably benign	0.01
R8697:Ttc37	UTSW	13	76180155	missense	probably damaging	1.00
R8867:Ttc37	UTSW	13	76131309	missense	probably damaging	0.99
R8872:Ttc37	UTSW	13	76185207	missense	probably damaging	1.00
R8876:Ttc37	UTSW	13	76175284	missense	probably benign	0.12
R8912:Ttc37	UTSW	13	76157242	splice site	probably benign
R9174:Ttc37	UTSW	13	76147774	missense	probably benign	0.00
R9334:Ttc37	UTSW	13	76132957	missense	possibly damaging	0.65
R9389:Ttc37	UTSW	13	76127039	missense	probably benign	0.02
R9443:Ttc37	UTSW	13	76118169	missense	probably benign	0.01
X0067:Ttc37	UTSW	13	76132933	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CACAGGCTTTTGGACACAATTTTG -3'
(R):5'- CAGCTAGATGTTGTACTTGACGG -3'

Sequencing Primer
(F):5'- GGCTTTTGGACACAATTTTGAAAGCC -3'
(R):5'- CCAAGATCACACCATGTATTAGATG -3'

Posted On

2014-08-25