Incidental Mutation 'R0139:Vcan'
ID 22207
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Name versican
Synonyms PG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 038424-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0139 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 13
Chromosomal Location 89655312-89742509 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89691261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2055 (S2055P)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: S2055P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: S2055P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: S1095P

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: S1095P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Ndor1 C T 2: 25,248,354 V405M possibly damaging Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nup133 A T 8: 123,929,343 N466K probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Ppargc1b A T 18: 61,315,963 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Sbf1 A T 15: 89,302,498 L866Q probably damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7995:Vcan UTSW 13 89691858 missense probably benign
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
R8103:Vcan UTSW 13 89657658 missense probably damaging 1.00
R8103:Vcan UTSW 13 89703320 nonsense probably null
R8124:Vcan UTSW 13 89704254 missense possibly damaging 0.93
R8162:Vcan UTSW 13 89704987 nonsense probably null
R8166:Vcan UTSW 13 89692736 missense probably benign 0.02
R8274:Vcan UTSW 13 89704970 missense probably benign 0.02
R8284:Vcan UTSW 13 89704335 missense possibly damaging 0.68
R8417:Vcan UTSW 13 89688743 missense probably benign 0.19
R8696:Vcan UTSW 13 89691098 missense probably benign 0.00
R8738:Vcan UTSW 13 89692320 missense probably benign 0.17
R8792:Vcan UTSW 13 89692111 missense possibly damaging 0.91
R8887:Vcan UTSW 13 89704907 missense probably benign
R9049:Vcan UTSW 13 89678105 missense probably damaging 1.00
R9074:Vcan UTSW 13 89691027 missense possibly damaging 0.95
R9095:Vcan UTSW 13 89704525 missense probably benign 0.32
R9172:Vcan UTSW 13 89679931 missense probably damaging 1.00
R9199:Vcan UTSW 13 89690496 nonsense probably null
R9259:Vcan UTSW 13 89690870 missense probably damaging 0.99
R9455:Vcan UTSW 13 89689333 missense probably damaging 1.00
R9476:Vcan UTSW 13 89703412 missense possibly damaging 0.95
R9477:Vcan UTSW 13 89693009 missense probably damaging 1.00
R9555:Vcan UTSW 13 89691540 missense
R9579:Vcan UTSW 13 89689594 missense possibly damaging 0.67
R9606:Vcan UTSW 13 89705372 missense probably damaging 1.00
R9645:Vcan UTSW 13 89692962 missense probably benign 0.00
R9659:Vcan UTSW 13 89691741 missense probably damaging 0.99
R9766:Vcan UTSW 13 89691128 missense probably benign 0.00
R9778:Vcan UTSW 13 89689811 missense probably damaging 1.00
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAAAAGAACTGTGGAGCGATTC -3'
(R):5'- GTGCCTGACTCAAAAGGACCTGAC -3'

Sequencing Primer
(F):5'- CTGTGGAGCGATTCAAAAGTC -3'
(R):5'- TCAGGTGAGCAATTAGCCTC -3'
Posted On 2013-04-16