Incidental Mutation 'R2047:Maml3'
ID222076
Institutional Source Beutler Lab
Gene Symbol Maml3
Ensembl Gene ENSMUSG00000061143
Gene Namemastermind like transcriptional coactivator 3
Synonyms
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2047 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51685907-52105076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51690445 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 939 (R939S)
Ref Sequence ENSEMBL: ENSMUSP00000112637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118075] [ENSMUST00000121440]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099104
Predicted Effect probably damaging
Transcript: ENSMUST00000118075
AA Change: R293S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113677
Gene: ENSMUSG00000061143
AA Change: R293S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
coiled coil region 90 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121440
AA Change: R939S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143
AA Change: R939S

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193403
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
Epb41l4a T C 18: 33,828,206 N425S probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Npas3 T C 12: 54,068,829 F827L probably damaging Het
Nrp1 G A 8: 128,498,096 probably benign Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Ptpn6 T C 6: 124,721,789 T480A probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Tub A G 7: 109,026,732 D230G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Maml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Maml3 APN 3 51690704 missense probably benign 0.13
IGL01138:Maml3 APN 3 51690558 missense possibly damaging 0.87
IGL02173:Maml3 APN 3 51690787 missense probably damaging 0.96
IGL02220:Maml3 APN 3 51690218 missense possibly damaging 0.94
IGL02725:Maml3 APN 3 52103774 missense probably damaging 0.97
IGL02838:Maml3 APN 3 51690090 missense probably damaging 1.00
R0683:Maml3 UTSW 3 51856752 nonsense probably null
R1966:Maml3 UTSW 3 52104139 missense unknown
R1980:Maml3 UTSW 3 52104052 missense unknown
R1989:Maml3 UTSW 3 51697758 missense probably damaging 0.98
R1992:Maml3 UTSW 3 51690757 missense probably benign 0.01
R2113:Maml3 UTSW 3 51690656 missense probably damaging 1.00
R2876:Maml3 UTSW 3 51690059 missense possibly damaging 0.86
R3176:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R3276:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R4191:Maml3 UTSW 3 51689969 missense probably benign
R4576:Maml3 UTSW 3 51856506 nonsense probably null
R4609:Maml3 UTSW 3 51855592 missense probably damaging 1.00
R4628:Maml3 UTSW 3 51796470 intron probably benign
R4734:Maml3 UTSW 3 51689875 missense probably damaging 1.00
R4776:Maml3 UTSW 3 51856532 missense probably benign 0.28
R4868:Maml3 UTSW 3 52103924 nonsense probably null
R4889:Maml3 UTSW 3 51694510 intron probably benign
R4891:Maml3 UTSW 3 51694510 intron probably benign
R4947:Maml3 UTSW 3 51856539 missense probably benign 0.01
R5011:Maml3 UTSW 3 51690775 missense possibly damaging 0.87
R5047:Maml3 UTSW 3 51690841 missense possibly damaging 0.88
R5344:Maml3 UTSW 3 52103725 missense probably damaging 0.99
R5743:Maml3 UTSW 3 52104132 missense unknown
R6724:Maml3 UTSW 3 51855875 missense probably damaging 1.00
R6885:Maml3 UTSW 3 51697579
R6938:Maml3 UTSW 3 52103738 missense probably damaging 0.98
R7581:Maml3 UTSW 3 51856768 missense probably benign 0.06
R7895:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R7978:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R8059:Maml3 UTSW 3 51856689 missense probably damaging 1.00
RF022:Maml3 UTSW 3 51856662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTGCTGTTTGGTCAGTCTT -3'
(R):5'- CCAACCAGGAATGTACAACATGA -3'

Sequencing Primer
(F):5'- GCTGGCGCCATTGTTGAATG -3'
(R):5'- ACACAGGAATGACCCAAATG -3'
Posted On2014-08-25