Incidental Mutation 'R2047:Ptpn6'
ID222095
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R2047 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124721789 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 480 (T480A)
Ref Sequence ENSEMBL: ENSMUSP00000133991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004375] [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]
Predicted Effect probably benign
Transcript: ENSMUST00000004375
SMART Domains Protein: ENSMUSP00000004375
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
PHB 39 201 1.01e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000004377
AA Change: T521A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: T521A

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083540
Predicted Effect probably benign
Transcript: ENSMUST00000112484
AA Change: T519A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: T519A

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145447
Predicted Effect probably benign
Transcript: ENSMUST00000171549
AA Change: T521A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: T521A

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172690
Predicted Effect probably benign
Transcript: ENSMUST00000173315
AA Change: T18A

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134274
Gene: ENSMUSG00000004266
AA Change: T18A

DomainStartEndE-ValueType
SCOP:d1eeoa_ 2 38 1e-3 SMART
PDB:3PS5|A 2 91 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174265
AA Change: T480A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: T480A

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189387
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
Epb41l4a T C 18: 33,828,206 N425S probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Maml3 C A 3: 51,690,445 R939S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Npas3 T C 12: 54,068,829 F827L probably damaging Het
Nrp1 G A 8: 128,498,096 probably benign Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Tub A G 7: 109,026,732 D230G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
caterpillar UTSW 6 124724984 missense probably benign
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
Flutterby UTSW 6 124721858 missense possibly damaging 0.89
Lepidopteran UTSW 6 124728172 missense probably damaging 1.00
Naphthalene UTSW 6 124721789 missense probably benign 0.42
spin UTSW 6 124728559 missense probably damaging 1.00
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
R6374:Ptpn6 UTSW 6 124732569 unclassified probably null
R7238:Ptpn6 UTSW 6 124721858 missense possibly damaging 0.89
R7381:Ptpn6 UTSW 6 124728172 missense probably damaging 1.00
R8297:Ptpn6 UTSW 6 124728651 missense possibly damaging 0.84
Z1176:Ptpn6 UTSW 6 124725076 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGGGAGGGTACGTGATATTC -3'
(R):5'- TGGAAAGCATCTCCACCAAG -3'

Sequencing Primer
(F):5'- GAGGGTACGTGATATTCCCATACTC -3'
(R):5'- GGGCAAGCCATCCCTTG -3'
Posted On2014-08-25