Incidental Mutation 'R2047:Tub'
ID222111
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Nametubby bipartite transcription factor
Synonymsrd5, tub
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2047 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108950338-109034460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109026732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 230 (D230G)
Ref Sequence ENSEMBL: ENSMUSP00000113580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474] [ENSMUST00000207583]
Predicted Effect probably benign
Transcript: ENSMUST00000033341
AA Change: D276G

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: D276G

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119474
AA Change: D230G

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: D230G

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147943
Predicted Effect probably benign
Transcript: ENSMUST00000207583
Meta Mutation Damage Score 0.4062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
Epb41l4a T C 18: 33,828,206 N425S probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Maml3 C A 3: 51,690,445 R939S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Npas3 T C 12: 54,068,829 F827L probably damaging Het
Nrp1 G A 8: 128,498,096 probably benign Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Ptpn6 T C 6: 124,721,789 T480A probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
R8120:Tub UTSW 7 109025596 splice site probably null
R8223:Tub UTSW 7 109029326 missense probably benign 0.33
RF005:Tub UTSW 7 109022639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCGCATAGTGTCCTTTTG -3'
(R):5'- AGTAACATTACCCATCCGGC -3'

Sequencing Primer
(F):5'- ACGCGCATAGTGTCCTTTTGATTTG -3'
(R):5'- GCACTGGCAAGCCCCTAAG -3'
Posted On2014-08-25