Incidental Mutation 'R1980:Ppid'
ID222116
Institutional Source Beutler Lab
Gene Symbol Ppid
Ensembl Gene ENSMUSG00000027804
Gene Namepeptidylprolyl isomerase D (cyclophilin D)
Synonymscyclophilin 40, 4930564J03Rik, cytoplasmic cyclophilin D, Ppidl, CYP-40
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location79591342-79603650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79593618 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 32 (I32F)
Ref Sequence ENSEMBL: ENSMUSP00000029382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029382]
Predicted Effect probably damaging
Transcript: ENSMUST00000029382
AA Change: I32F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029382
Gene: ENSMUSG00000027804
AA Change: I32F

DomainStartEndE-ValueType
Pfam:Pro_isomerase 19 183 1.5e-49 PFAM
low complexity region 208 222 N/A INTRINSIC
TPR 223 256 1.78e-1 SMART
TPR 273 306 2.59e-3 SMART
TPR 307 340 2.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162690
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein has been shown to possess PPIase activity and, similar to other family members, can bind to the immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Ppid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Ppid APN 3 79595277 missense probably damaging 1.00
IGL01718:Ppid APN 3 79593679 missense probably damaging 1.00
IGL02347:Ppid APN 3 79595219 missense probably benign 0.00
R1109:Ppid UTSW 3 79598861 missense probably benign 0.01
R1965:Ppid UTSW 3 79602299 nonsense probably null
R1966:Ppid UTSW 3 79602299 nonsense probably null
R4706:Ppid UTSW 3 79599052 missense probably benign
R4820:Ppid UTSW 3 79595197 splice site probably null
R5969:Ppid UTSW 3 79597717 missense probably damaging 1.00
R6243:Ppid UTSW 3 79603066 missense probably benign 0.01
R7246:Ppid UTSW 3 79591433 unclassified probably benign
R7341:Ppid UTSW 3 79600297 missense probably benign
R7576:Ppid UTSW 3 79600391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGTATGCATACCCGAGG -3'
(R):5'- GTCCCTTCTTAAGAGCAGGAC -3'

Sequencing Primer
(F):5'- GCAGCGTTATTCACAGTAGC -3'
(R):5'- GAGCAGGACTAATATACATATCAAGC -3'
Posted On2014-08-25