Incidental Mutation 'R0139:Sbf1'
ID 22212
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 038424-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.521) question?
Stock # R0139 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 15
Chromosomal Location 89288236-89315311 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89302498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 866 (L866Q)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585] [ENSMUST00000146637]
AlphaFold Q6ZPE2
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000123791
AA Change: L866Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: L866Q

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144585
AA Change: L866Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: L866Q

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146637
SMART Domains Protein: ENSMUSP00000122386
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
DENN 20 210 8.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Meta Mutation Damage Score 0.5122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Ndor1 C T 2: 25,248,354 V405M possibly damaging Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nup133 A T 8: 123,929,343 N466K probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Ppargc1b A T 18: 61,315,963 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Vcan A G 13: 89,691,261 S2055P probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89305575 missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89299743 missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89288716 missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89303278 missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89303215 unclassified probably benign
IGL01908:Sbf1 APN 15 89302726 missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89289044 missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89302505 nonsense probably null
IGL02150:Sbf1 APN 15 89295480 missense probably benign 0.00
IGL02284:Sbf1 APN 15 89305078 missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89307572 missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89305985 unclassified probably benign
IGL03025:Sbf1 APN 15 89289645 missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89293947 missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89289105 missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89289016 unclassified probably benign
IGL03397:Sbf1 APN 15 89288721 missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89295561 missense probably benign 0.26
R0528:Sbf1 UTSW 15 89288712 missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89302329 missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89304716 missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89305076 missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89294425 missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89302730 missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89306693 missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R2845:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R3788:Sbf1 UTSW 15 89299528 nonsense probably null
R4108:Sbf1 UTSW 15 89288585 unclassified probably benign
R4403:Sbf1 UTSW 15 89293954 missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89303481 missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89306926 missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89295246 missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89303112 nonsense probably null
R4697:Sbf1 UTSW 15 89315085 missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89302713 missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89288634 missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89308068 missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89305611 missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89293476 missense probably benign 0.29
R6256:Sbf1 UTSW 15 89300867 missense probably benign 0.06
R6490:Sbf1 UTSW 15 89304908 missense probably benign
R6933:Sbf1 UTSW 15 89300369 missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89305420 missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89306223 missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89294205 missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89293457 missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89295459 missense probably benign
R8788:Sbf1 UTSW 15 89301859 missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89289603 critical splice donor site probably null
R9516:Sbf1 UTSW 15 89300539 missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89307605 critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89295472 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGTGGTAAGGAAGACAGCACCCTC -3'
(R):5'- GCTTCATCAACCGCTTTGTGGAC -3'

Sequencing Primer
(F):5'- GTCTGGCAGCAGATACACTC -3'
(R):5'- TGGACAAAGTCTGCACAGAG -3'
Posted On 2013-04-16