Incidental Mutation 'R0139:Sbf1'
ID 22212
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 038424-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R0139 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 15
Chromosomal Location 89172439-89199514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89186701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 866 (L866Q)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585] [ENSMUST00000146637]
AlphaFold Q6ZPE2
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000123791
AA Change: L866Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: L866Q

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144585
AA Change: L866Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: L866Q

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146637
SMART Domains Protein: ENSMUSP00000122386
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
DENN 20 210 8.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Meta Mutation Damage Score 0.5122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik C T 8: 12,329,899 (GRCm39) S118L unknown Het
Adprs A G 4: 126,211,947 (GRCm39) Y122H probably damaging Het
Ankrd52 T C 10: 128,222,007 (GRCm39) S544P probably benign Het
Aopep A G 13: 63,338,298 (GRCm39) N558S probably benign Het
Arhgef7 A G 8: 11,850,503 (GRCm39) E111G probably damaging Het
Atp11a A G 8: 12,896,054 (GRCm39) M755V probably benign Het
Atp2a2 A G 5: 122,629,778 (GRCm39) I97T probably damaging Het
Bmp3 G A 5: 99,027,768 (GRCm39) D463N possibly damaging Het
Cacna2d4 T C 6: 119,255,230 (GRCm39) probably benign Het
Ccdc28a G A 10: 18,106,188 (GRCm39) S46F possibly damaging Het
Ccdc40 G A 11: 119,155,125 (GRCm39) G1122S probably benign Het
Cenpw T G 10: 30,076,455 (GRCm39) T8P probably benign Het
Cfap44 G C 16: 44,253,785 (GRCm39) G893R possibly damaging Het
Cimap3 A T 3: 105,906,886 (GRCm39) M171K possibly damaging Het
Cops7a A T 6: 124,938,323 (GRCm39) C110S probably damaging Het
Cstl1 A G 2: 148,597,245 (GRCm39) N134S probably damaging Het
Cyp2s1 G T 7: 25,511,114 (GRCm39) probably null Het
Dio2 T A 12: 90,696,617 (GRCm39) N124Y probably damaging Het
Ecel1 C A 1: 87,082,248 (GRCm39) G155V possibly damaging Het
Efr3a G T 15: 65,717,830 (GRCm39) V337F possibly damaging Het
Eva1b A C 4: 126,043,446 (GRCm39) H162P probably damaging Het
Exoc5 C T 14: 49,273,493 (GRCm39) E301K probably damaging Het
F13b G A 1: 139,435,941 (GRCm39) S249N probably damaging Het
Fam120b C T 17: 15,646,446 (GRCm39) probably benign Het
Gbf1 T C 19: 46,250,231 (GRCm39) L396S probably damaging Het
Gck T A 11: 5,859,139 (GRCm39) K143* probably null Het
Gck C A 11: 5,860,370 (GRCm39) V91L probably damaging Het
Glt8d2 T C 10: 82,496,644 (GRCm39) N138S probably damaging Het
Gm4884 T C 7: 40,692,387 (GRCm39) F119L probably benign Het
Igsf11 T C 16: 38,829,240 (GRCm39) S45P probably damaging Het
Iho1 T C 9: 108,289,695 (GRCm39) T176A probably damaging Het
Il10 G A 1: 130,950,271 (GRCm39) V142M probably damaging Het
Insc A T 7: 114,368,237 (GRCm39) H9L probably damaging Het
Iqsec1 G T 6: 90,786,740 (GRCm39) probably benign Het
Katnb1 A G 8: 95,825,050 (GRCm39) S611G possibly damaging Het
Kcnb1 A G 2: 166,947,459 (GRCm39) I463T possibly damaging Het
Lao1 A G 4: 118,821,399 (GRCm39) N90S probably benign Het
Med16 T A 10: 79,732,635 (GRCm39) M710L probably benign Het
Mroh2a G C 1: 88,185,524 (GRCm39) E1510D probably damaging Het
Mtus1 G A 8: 41,469,233 (GRCm39) probably benign Het
Mybpc3 A G 2: 90,950,682 (GRCm39) probably benign Het
Ndor1 C T 2: 25,138,366 (GRCm39) V405M possibly damaging Het
Nell2 A G 15: 95,330,782 (GRCm39) V213A probably benign Het
Nme8 T C 13: 19,862,018 (GRCm39) I204V probably benign Het
Nup133 A T 8: 124,656,082 (GRCm39) N466K probably benign Het
Nxt1 A G 2: 148,517,390 (GRCm39) T44A probably benign Het
Or14c46 T C 7: 85,918,187 (GRCm39) E270G probably benign Het
Or2ag15 A T 7: 106,340,832 (GRCm39) I103N probably benign Het
Or2y12 C T 11: 49,426,401 (GRCm39) L130F probably benign Het
Or4e1 T C 14: 52,700,669 (GRCm39) T239A probably damaging Het
Or4f7 A T 2: 111,644,699 (GRCm39) I124K possibly damaging Het
Or7e168 C T 9: 19,720,165 (GRCm39) L184F probably damaging Het
Pced1a T C 2: 130,263,827 (GRCm39) K275R probably benign Het
Pdcd11 A G 19: 47,099,398 (GRCm39) probably null Het
Phldb2 A C 16: 45,591,029 (GRCm39) probably benign Het
Piwil1 C A 5: 128,824,387 (GRCm39) S490Y probably damaging Het
Plekhh3 T C 11: 101,054,501 (GRCm39) probably benign Het
Ppargc1b A T 18: 61,449,034 (GRCm39) probably benign Het
Psg19 C T 7: 18,530,942 (GRCm39) V71I possibly damaging Het
Ptk6 T C 2: 180,838,724 (GRCm39) probably benign Het
Pus7 A G 5: 23,983,090 (GRCm39) S126P probably damaging Het
Rab6b T A 9: 103,017,576 (GRCm39) probably null Het
Ranbp3 G A 17: 57,016,272 (GRCm39) R347Q possibly damaging Het
Sanbr A T 11: 23,570,214 (GRCm39) probably benign Het
Slc25a34 A G 4: 141,349,663 (GRCm39) V164A possibly damaging Het
Smg1 A G 7: 117,751,898 (GRCm39) probably null Het
Spin1 G T 13: 51,303,048 (GRCm39) V214L probably benign Het
Spmip2 A T 3: 79,313,142 (GRCm39) Y72F probably damaging Het
Sptbn1 T C 11: 30,092,289 (GRCm39) N492S probably benign Het
Stk-ps2 A G 1: 46,068,955 (GRCm39) noncoding transcript Het
Taar7f T C 10: 23,926,312 (GRCm39) I302T probably benign Het
Tdrd1 C A 19: 56,831,630 (GRCm39) H340Q probably benign Het
Thumpd3 A G 6: 113,044,762 (GRCm39) D498G probably benign Het
Tpgs2 A G 18: 25,282,242 (GRCm39) L103P probably damaging Het
Trip10 A G 17: 57,568,633 (GRCm39) probably null Het
Trip6 A T 5: 137,310,436 (GRCm39) H269Q probably benign Het
Trmt12 T C 15: 58,744,743 (GRCm39) V47A possibly damaging Het
Trpm7 A T 2: 126,654,691 (GRCm39) S1416T probably benign Het
Tsks G A 7: 44,603,883 (GRCm39) A438T probably benign Het
Ttn T C 2: 76,727,630 (GRCm39) probably benign Het
Twf2 G A 9: 106,090,155 (GRCm39) V136M possibly damaging Het
Uty A C Y: 1,197,223 (GRCm39) Y115D probably damaging Het
Vcan A G 13: 89,839,380 (GRCm39) S2055P probably damaging Het
Yes1 A G 5: 32,842,039 (GRCm39) Q521R possibly damaging Het
Zfp114 A T 7: 23,880,685 (GRCm39) T344S possibly damaging Het
Zfp661 A T 2: 127,420,532 (GRCm39) V89D possibly damaging Het
Zfp91 A T 19: 12,747,834 (GRCm39) Y430N probably damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89,189,778 (GRCm39) missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89,183,946 (GRCm39) missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89,172,919 (GRCm39) missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89,187,481 (GRCm39) missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89,187,418 (GRCm39) unclassified probably benign
IGL01908:Sbf1 APN 15 89,186,929 (GRCm39) missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89,173,247 (GRCm39) missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89,186,708 (GRCm39) nonsense probably null
IGL02150:Sbf1 APN 15 89,179,683 (GRCm39) missense probably benign 0.00
IGL02284:Sbf1 APN 15 89,189,281 (GRCm39) missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89,191,775 (GRCm39) missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89,190,188 (GRCm39) unclassified probably benign
IGL03025:Sbf1 APN 15 89,173,848 (GRCm39) missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89,178,150 (GRCm39) missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89,173,308 (GRCm39) missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89,173,219 (GRCm39) unclassified probably benign
IGL03397:Sbf1 APN 15 89,172,924 (GRCm39) missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89,179,764 (GRCm39) missense probably benign 0.26
R0528:Sbf1 UTSW 15 89,172,915 (GRCm39) missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89,186,532 (GRCm39) missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89,188,919 (GRCm39) missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89,189,279 (GRCm39) missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89,178,628 (GRCm39) missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89,186,933 (GRCm39) missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89,190,896 (GRCm39) missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R2845:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R3788:Sbf1 UTSW 15 89,183,731 (GRCm39) nonsense probably null
R4108:Sbf1 UTSW 15 89,172,788 (GRCm39) unclassified probably benign
R4403:Sbf1 UTSW 15 89,178,157 (GRCm39) missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89,187,684 (GRCm39) missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89,191,129 (GRCm39) missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89,179,449 (GRCm39) missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89,187,315 (GRCm39) nonsense probably null
R4697:Sbf1 UTSW 15 89,199,288 (GRCm39) missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89,186,916 (GRCm39) missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89,172,837 (GRCm39) missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89,192,271 (GRCm39) missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89,189,814 (GRCm39) missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89,177,679 (GRCm39) missense probably benign 0.29
R6256:Sbf1 UTSW 15 89,185,070 (GRCm39) missense probably benign 0.06
R6490:Sbf1 UTSW 15 89,189,111 (GRCm39) missense probably benign
R6933:Sbf1 UTSW 15 89,184,572 (GRCm39) missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89,189,623 (GRCm39) missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89,190,426 (GRCm39) missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89,178,408 (GRCm39) missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89,177,660 (GRCm39) missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89,179,662 (GRCm39) missense probably benign
R8788:Sbf1 UTSW 15 89,186,062 (GRCm39) missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89,173,806 (GRCm39) critical splice donor site probably null
R9516:Sbf1 UTSW 15 89,184,742 (GRCm39) missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89,191,808 (GRCm39) critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89,179,675 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGTGGTAAGGAAGACAGCACCCTC -3'
(R):5'- GCTTCATCAACCGCTTTGTGGAC -3'

Sequencing Primer
(F):5'- GTCTGGCAGCAGATACACTC -3'
(R):5'- TGGACAAAGTCTGCACAGAG -3'
Posted On 2013-04-16