Incidental Mutation 'R2047:Nrp1'
ID222121
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2047 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 128498096 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure
Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026917
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
Epb41l4a T C 18: 33,828,206 N425S probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Maml3 C A 3: 51,690,445 R939S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Npas3 T C 12: 54,068,829 F827L probably damaging Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Ptpn6 T C 6: 124,721,789 T480A probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Tub A G 7: 109,026,732 D230G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
R8088:Nrp1 UTSW 8 128468516 nonsense probably null
R8193:Nrp1 UTSW 8 128460706 missense probably damaging 1.00
R8206:Nrp1 UTSW 8 128457957 missense probably damaging 0.99
R8245:Nrp1 UTSW 8 128487953 missense probably benign
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGTATCACATGTCCGGCTC -3'
(R):5'- TGGTAGAGATGATTCAAACATGCAG -3'

Sequencing Primer
(F):5'- ACATGTCCGGCTCTCATGTGG -3'
(R):5'- CAAAAGGGATGCTATCTATGACATC -3'
Posted On2014-08-25