Incidental Mutation 'R1980:Lyar'
ID222134
Institutional Source Beutler Lab
Gene Symbol Lyar
Ensembl Gene ENSMUSG00000067367
Gene NameLy1 antibody reactive clone
Synonyms
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38220470-38234306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38224709 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 12 (S12P)
Ref Sequence ENSEMBL: ENSMUSP00000121320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087514] [ENSMUST00000094833] [ENSMUST00000114106] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000123207] [ENSMUST00000126267] [ENSMUST00000130721] [ENSMUST00000132190] [ENSMUST00000136475] [ENSMUST00000146401] [ENSMUST00000152066] [ENSMUST00000155300] [ENSMUST00000154975] [ENSMUST00000202506] [ENSMUST00000143436] [ENSMUST00000138820]
Predicted Effect probably damaging
Transcript: ENSMUST00000087514
AA Change: S12P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084791
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.7e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094833
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114106
AA Change: S12P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109741
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 4.3e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114113
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123207
AA Change: S12P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121204
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130721
AA Change: S12P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122153
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131492
Predicted Effect probably damaging
Transcript: ENSMUST00000132190
AA Change: S12P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121320
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137577
Predicted Effect probably damaging
Transcript: ENSMUST00000146401
AA Change: S12P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000152066
AA Change: S12P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000155300
AA Change: S12P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122486
Gene: ENSMUSG00000067367
AA Change: S12P

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154975
AA Change: S12P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000202506
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Lyar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Lyar APN 5 38228047 splice site probably null
IGL01472:Lyar APN 5 38224722 missense possibly damaging 0.72
IGL02603:Lyar APN 5 38234061 missense probably damaging 0.99
veerie UTSW 5 38227858 missense probably benign 0.05
R2518:Lyar UTSW 5 38227932 missense probably benign 0.23
R4612:Lyar UTSW 5 38224709 missense possibly damaging 0.92
R4798:Lyar UTSW 5 38227886 missense possibly damaging 0.93
R4799:Lyar UTSW 5 38224779 missense probably damaging 1.00
R5973:Lyar UTSW 5 38227946 missense probably damaging 1.00
R5991:Lyar UTSW 5 38227865 missense probably damaging 0.98
R6045:Lyar UTSW 5 38234008 missense probably benign 0.21
R6284:Lyar UTSW 5 38225995 missense probably damaging 1.00
R6548:Lyar UTSW 5 38227858 missense probably benign 0.05
R6551:Lyar UTSW 5 38233272 missense probably damaging 1.00
R7051:Lyar UTSW 5 38224680 missense probably damaging 1.00
R7664:Lyar UTSW 5 38230817 missense probably benign 0.02
R7909:Lyar UTSW 5 38224728 missense probably damaging 1.00
R7938:Lyar UTSW 5 38230951 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACGCTGAGAACTTGGCTG -3'
(R):5'- CAACCTACTCAGTGTCTGCC -3'

Sequencing Primer
(F):5'- CTTCTCGGAGATCACTGGTAAAC -3'
(R):5'- ACTCAGTGTCTGCCTTCATTTTG -3'
Posted On2014-08-25