Incidental Mutation 'R1980:Zfp329'
ID222140
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12811468 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 43 (N43I)
Ref Sequence ENSEMBL: ENSMUSP00000113355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
Predicted Effect probably benign
Transcript: ENSMUST00000072222
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108546
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121215
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
R8130:Zfp329 UTSW 7 12810386 missense probably damaging 1.00
R8310:Zfp329 UTSW 7 12810189 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGTTGAGTGGCTTCCATG -3'
(R):5'- GCTCAGAATGTTCCTGAAGAAG -3'

Sequencing Primer
(F):5'- ATCGCCGTCAGCAGTTC -3'
(R):5'- TGTTCCTGAAGAAGAAAGTATTTCC -3'
Posted On2014-08-25