Incidental Mutation 'R2047:Npas3'
ID222141
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R2047 (G1)
Quality Score212
Status Validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54068829 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 827 (F827L)
Ref Sequence ENSEMBL: ENSMUSP00000152452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect probably damaging
Transcript: ENSMUST00000101432
AA Change: F845L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: F845L

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185390
Predicted Effect probably damaging
Transcript: ENSMUST00000223057
AA Change: F827L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223358
AA Change: F814L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
Epb41l4a T C 18: 33,828,206 N425S probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Maml3 C A 3: 51,690,445 R939S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Nrp1 G A 8: 128,498,096 probably benign Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Ptpn6 T C 6: 124,721,789 T480A probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Tub A G 7: 109,026,732 D230G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1687:Npas3 UTSW 12 54048875 splice site probably null
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2004:Npas3 UTSW 12 54067897 missense possibly damaging 0.63
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R3767:Npas3 UTSW 12 54069074 makesense probably null
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5524:Npas3 UTSW 12 54068938 missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
R7684:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R7724:Npas3 UTSW 12 54068341 missense possibly damaging 0.90
R7739:Npas3 UTSW 12 54068718 missense probably damaging 1.00
R7826:Npas3 UTSW 12 53831756 missense possibly damaging 0.92
R8017:Npas3 UTSW 12 54044679 missense probably damaging 1.00
R8019:Npas3 UTSW 12 54044679 missense probably damaging 1.00
R8034:Npas3 UTSW 12 53640529 missense probably damaging 1.00
R8422:Npas3 UTSW 12 54068509 missense probably benign
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Z1176:Npas3 UTSW 12 53501180 missense probably damaging 0.99
Z1177:Npas3 UTSW 12 53947206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTTGCTGTACACTGG -3'
(R):5'- ATACCGTTGCTGTAGACTGGG -3'

Sequencing Primer
(F):5'- AGGCCCTGCAGAGGTTG -3'
(R):5'- AGCGTGGAGAAGAGTCCCTC -3'
Posted On2014-08-25