Incidental Mutation 'R1980:Alg11'
ID222152
Institutional Source Beutler Lab
Gene Symbol Alg11
Ensembl Gene ENSMUSG00000063362
Gene Nameasparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Synonyms
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22060721-22071627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22061887 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 16 (F16I)
Ref Sequence ENSEMBL: ENSMUSP00000106365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000072572] [ENSMUST00000110737] [ENSMUST00000110738]
Predicted Effect probably benign
Transcript: ENSMUST00000006742
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072572
AA Change: F16I

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: F16I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110737
AA Change: F16I

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: F16I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110738
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131624
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Alg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Alg11 APN 8 22061983 missense probably benign 0.22
1mM(1):Alg11 UTSW 8 22074057 missense probably benign
R0240:Alg11 UTSW 8 22065452 missense possibly damaging 0.83
R1908:Alg11 UTSW 8 22065568 missense probably damaging 1.00
R2090:Alg11 UTSW 8 22065630 missense possibly damaging 0.80
R2147:Alg11 UTSW 8 22065293 missense probably damaging 1.00
R2159:Alg11 UTSW 8 22065845 missense probably benign 0.44
R2265:Alg11 UTSW 8 22065614 missense probably benign
R2760:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2761:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2762:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2763:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2764:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2877:Alg11 UTSW 8 22065358 missense possibly damaging 0.93
R4165:Alg11 UTSW 8 22065557 missense probably damaging 1.00
R4230:Alg11 UTSW 8 22065518 missense probably damaging 1.00
R4370:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4371:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4447:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4448:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4450:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4840:Alg11 UTSW 8 22068010 missense possibly damaging 0.91
R5859:Alg11 UTSW 8 22065841 missense probably benign 0.10
R5988:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7293:Alg11 UTSW 8 22065379 missense probably damaging 1.00
R7417:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7610:Alg11 UTSW 8 22065131 missense probably damaging 1.00
R8388:Alg11 UTSW 8 22062034 missense probably benign 0.03
X0019:Alg11 UTSW 8 22065424 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCCCTGAATCACCAGTCATC -3'
(R):5'- CCACCTGCATTACAGTATGGATG -3'

Sequencing Primer
(F):5'- CTGGAGCTCACTTTGTAGACCAG -3'
(R):5'- GGAAAAATGCAACCACCGTTTGTTC -3'
Posted On2014-08-25