Incidental Mutation 'R2047:Epb41l4a'
ID222167
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission 040054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2047 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33828206 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 425 (N425S)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably benign
Transcript: ENSMUST00000025234
AA Change: N425S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: N425S

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik A G 7: 131,146,107 F52S probably damaging Het
Acot12 T C 13: 91,783,003 S457P probably damaging Het
Adcy5 G A 16: 35,290,108 V882M possibly damaging Het
Ahnak A G 19: 9,014,300 D4316G possibly damaging Het
Aldh1l2 G A 10: 83,506,743 A401V probably damaging Het
Apol7e A G 15: 77,717,610 H136R probably benign Het
Arl5a A G 2: 52,412,060 probably null Het
Asns G T 6: 7,680,093 A341E probably damaging Het
C7 A G 15: 5,045,661 L183P probably damaging Het
Cacng2 C T 15: 78,118,837 A19T probably damaging Het
Ccr4 A G 9: 114,492,565 F144S probably damaging Het
Ckap2 A G 8: 22,168,747 V660A probably benign Het
Cramp1l A T 17: 25,003,215 Y176* probably null Het
Dgki A G 6: 36,913,646 S922P possibly damaging Het
Drd5 C T 5: 38,320,336 S224L probably damaging Het
Ei24 T C 9: 36,780,163 K341E probably benign Het
Eno2 A T 6: 124,767,696 probably benign Het
F13b T G 1: 139,508,223 C256G probably damaging Het
Gm6588 A G 5: 112,450,709 N374S probably benign Het
Gp6 A T 7: 4,373,271 probably benign Het
H2-Q7 A T 17: 35,440,147 R191S probably damaging Het
Ivns1abp T A 1: 151,351,631 S63R possibly damaging Het
Kcnj16 A G 11: 111,025,120 probably null Het
Lpcat4 T C 2: 112,244,797 probably null Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Maml3 C A 3: 51,690,445 R939S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Mrpl46 T A 7: 78,781,564 Y82F probably damaging Het
Mthfs T A 9: 89,215,303 I71N probably damaging Het
Nectin4 T C 1: 171,385,152 V351A possibly damaging Het
Npas3 T C 12: 54,068,829 F827L probably damaging Het
Nrp1 G A 8: 128,498,096 probably benign Het
Ocln C A 13: 100,535,124 A242S probably damaging Het
Olfr1164 A T 2: 88,093,893 N14K probably benign Het
Olfr288 T A 15: 98,187,039 T253S probably damaging Het
Olfr309 G A 7: 86,306,804 T103I probably damaging Het
Pappa T C 4: 65,231,141 probably benign Het
Ptpn6 T C 6: 124,721,789 T480A probably benign Het
Pycr1 A T 11: 120,641,686 D168E possibly damaging Het
Rnf6 T C 5: 146,211,864 T126A probably damaging Het
Slc25a39 G A 11: 102,405,831 probably benign Het
Slc35f4 G T 14: 49,303,572 probably benign Het
Sppl2a C T 2: 126,926,852 A112T probably damaging Het
Sptbn1 A C 11: 30,138,360 probably benign Het
Sqle T C 15: 59,326,058 Y376H probably benign Het
Terb1 A T 8: 104,485,462 Y296N probably damaging Het
Ttbk2 T C 2: 120,748,916 H506R probably damaging Het
Ttn T C 2: 76,907,535 D4220G probably benign Het
Tub A G 7: 109,026,732 D230G probably benign Het
Ube2d3 T A 3: 135,465,206 I137K probably benign Het
Vldlr G T 19: 27,234,838 C84F probably damaging Het
Vmn1r54 A T 6: 90,269,988 I295F probably damaging Het
Vmn2r56 A G 7: 12,732,991 S39P probably damaging Het
Zfp358 A G 8: 3,495,934 H172R probably damaging Het
Zfp619 T C 7: 39,537,638 C1031R probably damaging Het
Zfp777 A G 6: 48,044,346 I114T probably benign Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAAAACCGCATGGCCAGGAC -3'
(R):5'- AGCCTGTTCCCTAATGTGTTG -3'

Sequencing Primer
(F):5'- CAGGACAGGAAGCTTCTGGTC -3'
(R):5'- AGAGCAGTGGTTTCAGCC -3'
Posted On2014-08-25