Incidental Mutation 'R1980:Rel'
ID222170
Institutional Source Beutler Lab
Gene Symbol Rel
Ensembl Gene ENSMUSG00000020275
Gene Namereticuloendotheliosis oncogene
Synonymsc-Rel
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23736847-23770970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23742761 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 424 (G424D)
Ref Sequence ENSEMBL: ENSMUSP00000099928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102864]
Predicted Effect probably benign
Transcript: ENSMUST00000102864
AA Change: G424D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275
AA Change: G424D

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 10 178 8.1e-78 PFAM
IPT 185 280 7.64e-24 SMART
low complexity region 512 530 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Rel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Rel APN 11 23757043 missense probably benign 0.31
IGL00819:Rel APN 11 23743029 missense probably benign 0.13
IGL00906:Rel APN 11 23744266 missense probably benign 0.00
IGL01358:Rel APN 11 23761155 missense probably benign 0.06
IGL01820:Rel APN 11 23753218 missense probably benign 0.22
IGL01889:Rel APN 11 23757035 missense probably damaging 0.96
IGL03270:Rel APN 11 23742584 missense probably benign 0.16
Amun-ra UTSW 11 23757026 nonsense probably null
Fleur UTSW 11 unclassified
giza UTSW 11 23757010 missense probably damaging 1.00
Horus UTSW 11 23753215 critical splice donor site probably null
osirus UTSW 11 23742713 missense probably benign 0.00
R0766:Rel UTSW 11 23757010 missense probably damaging 1.00
R0924:Rel UTSW 11 23742439 missense probably benign 0.02
R0930:Rel UTSW 11 23742439 missense probably benign 0.02
R1312:Rel UTSW 11 23757010 missense probably damaging 1.00
R1339:Rel UTSW 11 23745763 missense probably damaging 1.00
R1584:Rel UTSW 11 23745546 missense probably damaging 1.00
R1981:Rel UTSW 11 23742761 missense probably benign
R1982:Rel UTSW 11 23742761 missense probably benign
R2513:Rel UTSW 11 23745823 missense probably damaging 1.00
R2870:Rel UTSW 11 23761129 missense probably benign
R2870:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R3617:Rel UTSW 11 23745780 missense probably damaging 1.00
R3976:Rel UTSW 11 23742939 missense probably benign 0.07
R4010:Rel UTSW 11 23761138 missense probably benign
R4067:Rel UTSW 11 23753215 critical splice donor site probably null
R5345:Rel UTSW 11 23742462 missense probably benign 0.00
R5866:Rel UTSW 11 23742724 nonsense probably null
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6562:Rel UTSW 11 23757026 nonsense probably null
R6886:Rel UTSW 11 23744304 missense probably benign 0.03
R7516:Rel UTSW 11 23742785 missense probably benign 0.00
R7522:Rel UTSW 11 23770676 splice site probably null
R7663:Rel UTSW 11 23742713 missense probably benign 0.00
R7873:Rel UTSW 11 23742957 missense probably benign 0.00
R7960:Rel UTSW 11 23744493 missense probably damaging 0.98
Z1176:Rel UTSW 11 23745472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGATGCTCACAAGTCTTGGG -3'
(R):5'- ACTATTCTTCATGCGGGTCC -3'

Sequencing Primer
(F):5'- CTCACAAGTCTTGGGTTGTCAG -3'
(R):5'- GTCCATCTCGAGTGGATTGCC -3'
Posted On2014-08-25