Incidental Mutation 'R2048:Adhfe1'
ID222174
Institutional Source Beutler Lab
Gene Symbol Adhfe1
Ensembl Gene ENSMUSG00000025911
Gene Namealcohol dehydrogenase, iron containing, 1
Synonyms6330565B14Rik
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location9547948-9580673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9563553 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 342 (K342R)
Ref Sequence ENSEMBL: ENSMUSP00000116627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000144177]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115480
Predicted Effect probably benign
Transcript: ENSMUST00000144177
AA Change: K342R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911
AA Change: K342R

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145176
Predicted Effect unknown
Transcript: ENSMUST00000190654
AA Change: K333R
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Adhfe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Adhfe1 APN 1 9566863 missense probably benign
IGL01735:Adhfe1 APN 1 9548148 missense possibly damaging 0.90
IGL02862:Adhfe1 APN 1 9553811 missense probably damaging 1.00
IGL02891:Adhfe1 APN 1 9558171 missense probably benign
IGL03198:Adhfe1 APN 1 9549952 splice site probably benign
IGL03297:Adhfe1 APN 1 9549948 splice site probably benign
R0095:Adhfe1 UTSW 1 9560177 missense possibly damaging 0.79
R0180:Adhfe1 UTSW 1 9563857 missense probably benign 0.00
R0347:Adhfe1 UTSW 1 9553430 missense probably benign 0.00
R0590:Adhfe1 UTSW 1 9548153 critical splice donor site probably null
R1509:Adhfe1 UTSW 1 9553446 missense probably benign 0.03
R1606:Adhfe1 UTSW 1 9553473 critical splice donor site probably null
R1720:Adhfe1 UTSW 1 9566900 missense probably benign 0.01
R3918:Adhfe1 UTSW 1 9576216 missense probably damaging 0.99
R4375:Adhfe1 UTSW 1 9561628 intron probably benign
R4576:Adhfe1 UTSW 1 9553754 missense probably damaging 1.00
R4653:Adhfe1 UTSW 1 9550578 intron probably benign
R4724:Adhfe1 UTSW 1 9576250 missense probably damaging 0.99
R4760:Adhfe1 UTSW 1 9563523 missense probably damaging 0.97
R4859:Adhfe1 UTSW 1 9558213 missense probably damaging 1.00
R4967:Adhfe1 UTSW 1 9566804 missense probably benign 0.11
R4970:Adhfe1 UTSW 1 9558238 missense possibly damaging 0.92
R5087:Adhfe1 UTSW 1 9561626 intron probably benign
R6146:Adhfe1 UTSW 1 9553718 missense probably damaging 0.98
R7013:Adhfe1 UTSW 1 9550591 intron probably benign
R7084:Adhfe1 UTSW 1 9566805 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGTACACCATGTAGAGCCC -3'
(R):5'- GAACAGCTCTTCCAACACTCTG -3'

Sequencing Primer
(F):5'- GCCCTGTGAGTGACAATACAGTC -3'
(R):5'- CTCTGACATGACTAGAACTATGAGC -3'
Posted On2014-08-25