Incidental Mutation 'R2048:Cyp51'
ID222186
Institutional Source Beutler Lab
Gene Symbol Cyp51
Ensembl Gene ENSMUSG00000001467
Gene Namecytochrome P450, family 51
Synonyms
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4081145-4104746 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 4086636 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001507]
Predicted Effect probably benign
Transcript: ENSMUST00000001507
SMART Domains Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:p450 61 496 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129448
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Cyp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Cyp51 APN 5 4083247 missense probably damaging 1.00
IGL02047:Cyp51 APN 5 4099244 missense possibly damaging 0.86
IGL02191:Cyp51 APN 5 4100147 missense probably benign 0.05
IGL02492:Cyp51 APN 5 4104304 missense probably benign 0.01
IGL03209:Cyp51 APN 5 4104195 missense probably damaging 1.00
PIT4515001:Cyp51 UTSW 5 4099122 critical splice donor site probably null
PIT4520001:Cyp51 UTSW 5 4101200 missense probably damaging 1.00
R0535:Cyp51 UTSW 5 4099202 missense probably benign 0.00
R2165:Cyp51 UTSW 5 4086594 missense probably damaging 1.00
R2851:Cyp51 UTSW 5 4099183 missense probably damaging 1.00
R3975:Cyp51 UTSW 5 4091877 missense probably damaging 0.97
R4799:Cyp51 UTSW 5 4083256 missense probably damaging 1.00
R5699:Cyp51 UTSW 5 4101213 missense probably damaging 1.00
R6163:Cyp51 UTSW 5 4100199 missense probably damaging 1.00
R6484:Cyp51 UTSW 5 4086627 missense probably benign 0.07
R7046:Cyp51 UTSW 5 4100188 missense probably damaging 1.00
R7155:Cyp51 UTSW 5 4087846 missense possibly damaging 0.90
R7877:Cyp51 UTSW 5 4102929 missense probably damaging 1.00
R7904:Cyp51 UTSW 5 4100173 missense probably damaging 0.99
R7960:Cyp51 UTSW 5 4102929 missense probably damaging 1.00
R7987:Cyp51 UTSW 5 4100173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAGGGCAGTTAATGAAGG -3'
(R):5'- CAGGCTTTAGTTCTAGTTGCACTG -3'

Sequencing Primer
(F):5'- TCTCACCAGCTCCAAATGG -3'
(R):5'- GTTGGCCCACTTGTAAATCACTAAG -3'
Posted On2014-08-25