Incidental Mutation 'R2048:Gtpbp6'
ID222197
Institutional Source Beutler Lab
Gene Symbol Gtpbp6
Ensembl Gene ENSMUSG00000033434
Gene NameGTP binding protein 6 (putative)
SynonymsPgbpll, pgpl
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2048 (G1)
Quality Score201
Status Validated
Chromosome5
Chromosomal Location110103975-110108197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110107065 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 87 (V87G)
Ref Sequence ENSEMBL: ENSMUSP00000117817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077220] [ENSMUST00000086686] [ENSMUST00000086687] [ENSMUST00000112528] [ENSMUST00000112534] [ENSMUST00000135409] [ENSMUST00000140538] [ENSMUST00000147631]
Predicted Effect probably benign
Transcript: ENSMUST00000077220
AA Change: V150G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076458
Gene: ENSMUSG00000033434
AA Change: V150G

DomainStartEndE-ValueType
low complexity region 50 83 N/A INTRINSIC
Pfam:GTP-bdg_N 107 198 9.1e-15 PFAM
Pfam:GTP-bdg_M 200 279 1.9e-17 PFAM
Pfam:MMR_HSR1 286 404 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086686
SMART Domains Protein: ENSMUSP00000083891
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086687
SMART Domains Protein: ENSMUSP00000083892
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 48 355 1e-70 SMART
PDB:1AOD|A 57 228 1e-12 PDB
Blast:PLCXc 70 228 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112528
SMART Domains Protein: ENSMUSP00000108147
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112534
SMART Domains Protein: ENSMUSP00000108153
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 111 2e-21 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 121 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131918
Predicted Effect probably damaging
Transcript: ENSMUST00000135409
AA Change: V87G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117817
Gene: ENSMUSG00000033434
AA Change: V87G

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
coiled coil region 185 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138881
Predicted Effect probably benign
Transcript: ENSMUST00000140538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144162
Predicted Effect probably benign
Transcript: ENSMUST00000147631
SMART Domains Protein: ENSMUSP00000122236
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199496
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Gtpbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gtpbp6 APN 5 110104379 missense probably benign 0.08
IGL03330:Gtpbp6 APN 5 110107063 missense possibly damaging 0.95
R0457:Gtpbp6 UTSW 5 110106742 missense probably damaging 1.00
R1424:Gtpbp6 UTSW 5 110104289 unclassified probably null
R2012:Gtpbp6 UTSW 5 110104924 missense probably damaging 0.98
R4520:Gtpbp6 UTSW 5 110107859 missense probably benign 0.41
R4629:Gtpbp6 UTSW 5 110106908 missense possibly damaging 0.95
R4762:Gtpbp6 UTSW 5 110104320 missense probably damaging 1.00
R4878:Gtpbp6 UTSW 5 110107311 unclassified probably benign
R5050:Gtpbp6 UTSW 5 110104701 unclassified probably benign
R5174:Gtpbp6 UTSW 5 110108117 missense possibly damaging 0.91
R5327:Gtpbp6 UTSW 5 110106904 missense probably damaging 1.00
R5450:Gtpbp6 UTSW 5 110107125 missense probably damaging 0.99
R5685:Gtpbp6 UTSW 5 110104939 missense probably damaging 1.00
R5773:Gtpbp6 UTSW 5 110106891 missense possibly damaging 0.94
R5793:Gtpbp6 UTSW 5 110107228 missense probably benign 0.01
R7205:Gtpbp6 UTSW 5 110104612 missense probably damaging 1.00
R7263:Gtpbp6 UTSW 5 110104049 missense probably benign 0.01
R7623:Gtpbp6 UTSW 5 110105084 missense probably damaging 1.00
R7790:Gtpbp6 UTSW 5 110104386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCACGTTCAGGAACAC -3'
(R):5'- GCGGTTTCATCCCAGAGCTAAC -3'

Sequencing Primer
(F):5'- CACGTTCAGGAACACGGACG -3'
(R):5'- GAGCTAACCCTGTCCACCG -3'
Posted On2014-08-25