Incidental Mutation 'R0139:Ppargc1b'
ID22220
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 beta
SynonymsPGC-1beta/ERRL1, 4631412G21Rik
MMRRC Submission 038424-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R0139 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location61298136-61400431 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 61315963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
Predicted Effect probably benign
Transcript: ENSMUST00000063307
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075299
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Ndor1 C T 2: 25,248,354 V405M possibly damaging Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nup133 A T 8: 123,929,343 N466K probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Sbf1 A T 15: 89,302,498 L866Q probably damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Vcan A G 13: 89,691,261 S2055P probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61323164 missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61310435 missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61310875 nonsense probably null
IGL02176:Ppargc1b APN 18 61310874 missense probably damaging 1.00
IGL02183:Ppargc1b APN 18 61309096 critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61323151 missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61298739 missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61312243 missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61307684 missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61298766 missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61307694 missense probably damaging 1.00
R0194:Ppargc1b UTSW 18 61307945 missense possibly damaging 0.94
R0412:Ppargc1b UTSW 18 61315861 missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61302739 missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61311441 missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61310606 missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61307204 splice site probably null
R1758:Ppargc1b UTSW 18 61298786 splice site probably null
R1951:Ppargc1b UTSW 18 61298777 missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2112:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61311220 nonsense probably null
R2432:Ppargc1b UTSW 18 61307799 missense possibly damaging 0.93
R3612:Ppargc1b UTSW 18 61310556 missense probably benign 0.07
R3848:Ppargc1b UTSW 18 61311042 missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61311376 missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61382469 nonsense probably null
R4502:Ppargc1b UTSW 18 61302679 missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61311257 missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61307265 missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61310487 missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61307654 missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61302644 missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61315805 missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61309063 missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61307568 missense probably benign
R5719:Ppargc1b UTSW 18 61307568 missense probably benign
R5876:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61298766 missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6135:Ppargc1b UTSW 18 61315909 missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61307774 missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R7033:Ppargc1b UTSW 18 61307714 missense probably damaging 0.96
R7316:Ppargc1b UTSW 18 61307838 missense probably damaging 0.97
R7560:Ppargc1b UTSW 18 61312210 missense probably damaging 1.00
R8007:Ppargc1b UTSW 18 61310494 missense possibly damaging 0.55
R8374:Ppargc1b UTSW 18 61310493 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGATAAGGTCCGGGGAAATCTCAC -3'
(R):5'- CCTGCTACCAAGGATGAAGAGAAGC -3'

Sequencing Primer
(F):5'- AGTGAAAGCTCGTCCACGTC -3'
(R):5'- gtgagtggcagagccag -3'
Posted On2013-04-16