Incidental Mutation 'R2048:Fbxo21'
ID222201
Institutional Source Beutler Lab
Gene Symbol Fbxo21
Ensembl Gene ENSMUSG00000032898
Gene NameF-box protein 21
Synonyms
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location117976730-118010201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118008104 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 597 (N597K)
Ref Sequence ENSEMBL: ENSMUSP00000143873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035579] [ENSMUST00000202447]
Predicted Effect probably damaging
Transcript: ENSMUST00000035579
AA Change: N590K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035506
Gene: ENSMUSG00000032898
AA Change: N590K

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000201611
AA Change: N473K
Predicted Effect probably damaging
Transcript: ENSMUST00000202447
AA Change: N597K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143873
Gene: ENSMUSG00000032898
AA Change: N597K

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Fbxo21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Fbxo21 APN 5 117988790 missense probably benign 0.04
IGL02131:Fbxo21 APN 5 118002090 missense possibly damaging 0.76
IGL02156:Fbxo21 APN 5 117994668 splice site probably benign
IGL02195:Fbxo21 APN 5 118002154 missense probably damaging 1.00
IGL02702:Fbxo21 APN 5 118000510 missense probably damaging 1.00
PIT1430001:Fbxo21 UTSW 5 117977866 missense possibly damaging 0.68
R0008:Fbxo21 UTSW 5 118008013 missense possibly damaging 0.63
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0089:Fbxo21 UTSW 5 118008143 missense probably benign
R0101:Fbxo21 UTSW 5 117995456 missense probably damaging 1.00
R0815:Fbxo21 UTSW 5 117995508 splice site probably benign
R0866:Fbxo21 UTSW 5 117977033 missense probably benign 0.01
R1673:Fbxo21 UTSW 5 118008064 missense probably benign 0.27
R2063:Fbxo21 UTSW 5 117976966 missense probably benign 0.45
R2161:Fbxo21 UTSW 5 117995386 missense probably damaging 1.00
R2224:Fbxo21 UTSW 5 118008123 missense probably damaging 1.00
R3872:Fbxo21 UTSW 5 118000329 missense possibly damaging 0.70
R4750:Fbxo21 UTSW 5 118000468 missense probably benign 0.10
R5807:Fbxo21 UTSW 5 117976868 missense probably benign 0.01
R6075:Fbxo21 UTSW 5 117988883 missense probably damaging 0.97
R6528:Fbxo21 UTSW 5 118000356 missense probably benign 0.25
R7494:Fbxo21 UTSW 5 118000323 missense possibly damaging 0.86
R7498:Fbxo21 UTSW 5 118002174 critical splice donor site probably null
R7801:Fbxo21 UTSW 5 117986124 missense probably damaging 0.96
R7857:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R7940:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
Z1177:Fbxo21 UTSW 5 117989171 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGGAGGGTTTCAGCAGAG -3'
(R):5'- GCACACCATCTAAAGTGGGGAG -3'

Sequencing Primer
(F):5'- CAGAGAGCCATTGTGGAAAGC -3'
(R):5'- TGTCCTGTGCTGACTCCAGG -3'
Posted On2014-08-25