Incidental Mutation 'R1980:Apol7c'
ID 222204
Institutional Source Beutler Lab
Gene Symbol Apol7c
Ensembl Gene ENSMUSG00000044309
Gene Name apolipoprotein L 7c
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1980 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 77524852-77533316 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77526044 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000050745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062562] [ENSMUST00000230863]
AlphaFold Q8C6E1
Predicted Effect probably benign
Transcript: ENSMUST00000062562
AA Change: V234A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050745
Gene: ENSMUSG00000044309
AA Change: V234A

Pfam:ApoL 20 81 1.7e-12 PFAM
Pfam:ApoL 77 367 5.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230863
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Apol7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Apol7c APN 15 77526437 missense probably damaging 1.00
IGL01653:Apol7c APN 15 77526300 missense probably damaging 1.00
IGL02169:Apol7c APN 15 77526416 missense possibly damaging 0.87
IGL02262:Apol7c APN 15 77525813 missense probably benign 0.20
IGL02375:Apol7c APN 15 77528849 missense probably damaging 0.98
IGL02645:Apol7c APN 15 77528883 missense probably benign 0.19
IGL02934:Apol7c APN 15 77526118 missense possibly damaging 0.51
IGL03127:Apol7c APN 15 77525906 missense probably benign 0.16
R0130:Apol7c UTSW 15 77526362 missense possibly damaging 0.52
R0659:Apol7c UTSW 15 77526273 missense probably damaging 0.99
R1638:Apol7c UTSW 15 77526218 missense probably damaging 0.97
R4366:Apol7c UTSW 15 77526389 missense probably benign 0.07
R4466:Apol7c UTSW 15 77526464 missense probably benign 0.00
R4624:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4629:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4706:Apol7c UTSW 15 77525723 missense probably benign 0.05
R5367:Apol7c UTSW 15 77526147 missense probably damaging 1.00
R5586:Apol7c UTSW 15 77526399 missense possibly damaging 0.81
R6239:Apol7c UTSW 15 77526431 missense probably benign 0.28
R6860:Apol7c UTSW 15 77526074 missense probably benign 0.02
R7179:Apol7c UTSW 15 77525643 missense probably benign 0.01
R7234:Apol7c UTSW 15 77525675 nonsense probably null
R7513:Apol7c UTSW 15 77525711 missense possibly damaging 0.51
R7779:Apol7c UTSW 15 77525746 missense probably damaging 0.98
R8499:Apol7c UTSW 15 77526080 missense possibly damaging 0.88
R9335:Apol7c UTSW 15 77525689 missense probably benign 0.00
R9354:Apol7c UTSW 15 77525912 missense possibly damaging 0.51
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25