Incidental Mutation 'R1980:Apol7c'
ID 222204
Institutional Source Beutler Lab
Gene Symbol Apol7c
Ensembl Gene ENSMUSG00000044309
Gene Name apolipoprotein L 7c
Synonyms 2210421G13Rik
MMRRC Submission 039992-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1980 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 77409052-77417516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77410244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000050745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062562] [ENSMUST00000230863]
AlphaFold Q8C6E1
Predicted Effect probably benign
Transcript: ENSMUST00000062562
AA Change: V234A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050745
Gene: ENSMUSG00000044309
AA Change: V234A

DomainStartEndE-ValueType
Pfam:ApoL 20 81 1.7e-12 PFAM
Pfam:ApoL 77 367 5.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230863
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A C 11: 100,386,702 (GRCm39) I620S possibly damaging Het
Acot8 A G 2: 164,636,964 (GRCm39) F262S probably damaging Het
Adgb C T 10: 10,309,242 (GRCm39) V246I probably benign Het
Akap9 T A 5: 4,022,771 (GRCm39) M1200K probably damaging Het
Alg11 T A 8: 22,551,903 (GRCm39) F16I possibly damaging Het
Arhgap19 T G 19: 41,776,784 (GRCm39) I122L possibly damaging Het
Arhgef37 A G 18: 61,641,767 (GRCm39) S201P probably damaging Het
Asgr1 A T 11: 69,945,772 (GRCm39) D16V probably damaging Het
Camta2 A T 11: 70,573,308 (GRCm39) C227S probably benign Het
Cd22 A T 7: 30,572,658 (GRCm39) L317Q probably damaging Het
Cenpf A T 1: 189,386,112 (GRCm39) I2056K probably benign Het
Cenpi T A X: 133,218,782 (GRCm39) F161L possibly damaging Het
Ciapin1 C T 8: 95,559,161 (GRCm39) V43I probably benign Het
Cox5b-ps T G 13: 21,685,294 (GRCm39) T99P possibly damaging Het
Dach1 A G 14: 98,068,777 (GRCm39) L601P probably damaging Het
Ddx11 T A 17: 66,455,734 (GRCm39) L711Q probably damaging Het
Dsg1a A T 18: 20,471,707 (GRCm39) N653I probably damaging Het
Fezf2 G T 14: 12,344,405 (GRCm38) P261T probably benign Het
Galnt5 T C 2: 57,914,735 (GRCm39) probably null Het
Gemin5 A G 11: 58,027,743 (GRCm39) L935P probably damaging Het
Gm9507 A T 10: 77,647,519 (GRCm39) C53* probably null Het
Irgm2 A G 11: 58,110,902 (GRCm39) I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klf12 A C 14: 100,387,162 (GRCm39) probably null Het
Lpp C T 16: 24,480,451 (GRCm39) P73L probably damaging Het
Lrrc34 G A 3: 30,696,890 (GRCm39) H127Y probably benign Het
Lyar T C 5: 38,382,053 (GRCm39) S12P probably damaging Het
Maml3 A G 3: 52,011,473 (GRCm39) I31T unknown Het
Mei1 A G 15: 81,987,513 (GRCm39) N859S probably benign Het
Minar2 T A 18: 59,208,739 (GRCm39) M129K probably damaging Het
Mysm1 A T 4: 94,840,450 (GRCm39) N655K probably benign Het
Npnt T C 3: 132,653,893 (GRCm39) I29M probably benign Het
Nrxn1 A G 17: 91,395,746 (GRCm39) W137R probably benign Het
Numb C T 12: 83,844,118 (GRCm39) probably null Het
Obsl1 A G 1: 75,482,480 (GRCm39) F130S probably damaging Het
Or2h1 T G 17: 37,404,295 (GRCm39) Q157P probably damaging Het
Or4k47 T A 2: 111,451,586 (GRCm39) I278F probably benign Het
Pbx4 T C 8: 70,322,776 (GRCm39) V294A probably benign Het
Pde4dip A C 3: 97,664,312 (GRCm39) L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 (GRCm39) A319T probably benign Het
Ppid A T 3: 79,500,925 (GRCm39) I32F probably damaging Het
Ppp4r3c1 A T X: 88,975,051 (GRCm39) V382E probably damaging Het
Prkcsh A G 9: 21,924,164 (GRCm39) D458G probably damaging Het
Prr27 A G 5: 87,991,261 (GRCm39) E291G probably benign Het
Psme4 A T 11: 30,782,615 (GRCm39) K923N possibly damaging Het
Rab25 T C 3: 88,450,765 (GRCm39) T45A probably damaging Het
Rapgef1 C T 2: 29,612,239 (GRCm39) P630S probably benign Het
Rasa2 T C 9: 96,452,821 (GRCm39) D355G probably damaging Het
Rel C T 11: 23,692,761 (GRCm39) G424D probably benign Het
Rtn4 A T 11: 29,658,634 (GRCm39) E929D probably benign Het
Samt3 A C X: 85,090,740 (GRCm39) M211L probably benign Het
Slk T G 19: 47,600,428 (GRCm39) I151S probably damaging Het
Spin1 T A 13: 51,298,506 (GRCm39) V175D probably damaging Het
Ssxb10 A G X: 8,197,258 (GRCm39) D77G probably benign Het
Ticam1 C T 17: 56,578,555 (GRCm39) R180H probably damaging Het
Tmem151b G C 17: 45,856,387 (GRCm39) P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 (GRCm39) Y10S probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpm1 T C 7: 63,858,182 (GRCm39) Y225H possibly damaging Het
Ttc17 T C 2: 94,157,049 (GRCm39) N411S probably benign Het
Tyro3 A G 2: 119,639,298 (GRCm39) D335G probably benign Het
Unc79 C A 12: 102,977,538 (GRCm39) Y180* probably null Het
Upp1 A T 11: 9,084,872 (GRCm39) D197V possibly damaging Het
Vmn1r226 T A 17: 20,908,308 (GRCm39) M180K possibly damaging Het
Vtn T A 11: 78,392,724 (GRCm39) I434N probably damaging Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Zfp819 A G 7: 43,265,885 (GRCm39) T47A probably benign Het
Zyg11b G A 4: 108,123,127 (GRCm39) T280I probably damaging Het
Other mutations in Apol7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Apol7c APN 15 77,410,637 (GRCm39) missense probably damaging 1.00
IGL01653:Apol7c APN 15 77,410,500 (GRCm39) missense probably damaging 1.00
IGL02169:Apol7c APN 15 77,410,616 (GRCm39) missense possibly damaging 0.87
IGL02262:Apol7c APN 15 77,410,013 (GRCm39) missense probably benign 0.20
IGL02375:Apol7c APN 15 77,413,049 (GRCm39) missense probably damaging 0.98
IGL02645:Apol7c APN 15 77,413,083 (GRCm39) missense probably benign 0.19
IGL02934:Apol7c APN 15 77,410,318 (GRCm39) missense possibly damaging 0.51
IGL03127:Apol7c APN 15 77,410,106 (GRCm39) missense probably benign 0.16
R0130:Apol7c UTSW 15 77,410,562 (GRCm39) missense possibly damaging 0.52
R0659:Apol7c UTSW 15 77,410,473 (GRCm39) missense probably damaging 0.99
R1638:Apol7c UTSW 15 77,410,418 (GRCm39) missense probably damaging 0.97
R4366:Apol7c UTSW 15 77,410,589 (GRCm39) missense probably benign 0.07
R4466:Apol7c UTSW 15 77,410,664 (GRCm39) missense probably benign 0.00
R4624:Apol7c UTSW 15 77,410,595 (GRCm39) missense probably damaging 1.00
R4629:Apol7c UTSW 15 77,410,595 (GRCm39) missense probably damaging 1.00
R4706:Apol7c UTSW 15 77,409,923 (GRCm39) missense probably benign 0.05
R5367:Apol7c UTSW 15 77,410,347 (GRCm39) missense probably damaging 1.00
R5586:Apol7c UTSW 15 77,410,599 (GRCm39) missense possibly damaging 0.81
R6239:Apol7c UTSW 15 77,410,631 (GRCm39) missense probably benign 0.28
R6860:Apol7c UTSW 15 77,410,274 (GRCm39) missense probably benign 0.02
R7179:Apol7c UTSW 15 77,409,843 (GRCm39) missense probably benign 0.01
R7234:Apol7c UTSW 15 77,409,875 (GRCm39) nonsense probably null
R7513:Apol7c UTSW 15 77,409,911 (GRCm39) missense possibly damaging 0.51
R7779:Apol7c UTSW 15 77,409,946 (GRCm39) missense probably damaging 0.98
R8499:Apol7c UTSW 15 77,410,280 (GRCm39) missense possibly damaging 0.88
R9335:Apol7c UTSW 15 77,409,889 (GRCm39) missense probably benign 0.00
R9354:Apol7c UTSW 15 77,410,112 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGGCTTTCTGCACCTGTTTAG -3'
(R):5'- TCTGGAGTCCTGACCATCCTTG -3'

Sequencing Primer
(F):5'- CTGCACCTGTTTAGTGGTTTG -3'
(R):5'- TGGCACCTGTGACAGCAG -3'
Posted On 2014-08-25