Incidental Mutation 'R2048:Cyp3a13'
ID222210
Institutional Source Beutler Lab
Gene Symbol Cyp3a13
Ensembl Gene ENSMUSG00000029727
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 13
Synonymssteroid inducible, IIIAm2
MMRRC Submission 040055-MU
Accession Numbers

Genbank: NM_007819

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137892932-137921619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137909975 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 204 (V204E)
Ref Sequence ENSEMBL: ENSMUSP00000031741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031741]
Predicted Effect probably damaging
Transcript: ENSMUST00000031741
AA Change: V204E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031741
Gene: ENSMUSG00000029727
AA Change: V204E

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:p450 38 493 1.3e-130 PFAM
Meta Mutation Damage Score 0.7722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent alterations in hematology, plasma clinical chemistry or pathology. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Cyp3a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Cyp3a13 APN 5 137911933 missense probably benign 0.08
IGL01879:Cyp3a13 APN 5 137919003 missense probably benign
IGL01886:Cyp3a13 APN 5 137898820 missense probably damaging 1.00
IGL02048:Cyp3a13 APN 5 137918995 splice site probably benign
IGL02102:Cyp3a13 APN 5 137911603 missense probably benign 0.00
IGL02285:Cyp3a13 APN 5 137909967 missense probably benign 0.38
IGL03213:Cyp3a13 APN 5 137894267 utr 3 prime probably benign
IGL03238:Cyp3a13 APN 5 137898889 missense probably damaging 0.99
G4846:Cyp3a13 UTSW 5 137898823 missense possibly damaging 0.55
IGL02988:Cyp3a13 UTSW 5 137899010 nonsense probably null
PIT4486001:Cyp3a13 UTSW 5 137909966 missense probably benign 0.17
R0319:Cyp3a13 UTSW 5 137898862 missense probably damaging 1.00
R1024:Cyp3a13 UTSW 5 137894364 missense possibly damaging 0.56
R1189:Cyp3a13 UTSW 5 137911630 splice site probably null
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1501:Cyp3a13 UTSW 5 137911630 splice site probably null
R1838:Cyp3a13 UTSW 5 137911632 splice site probably null
R1956:Cyp3a13 UTSW 5 137909942 missense probably benign 0.02
R1981:Cyp3a13 UTSW 5 137911856 missense probably damaging 0.97
R2140:Cyp3a13 UTSW 5 137921454 missense possibly damaging 0.93
R4844:Cyp3a13 UTSW 5 137917551 missense probably benign
R5001:Cyp3a13 UTSW 5 137898916 missense probably benign 0.00
R5062:Cyp3a13 UTSW 5 137898899 missense possibly damaging 0.52
R5420:Cyp3a13 UTSW 5 137898981 missense probably damaging 1.00
R5855:Cyp3a13 UTSW 5 137919056 missense probably damaging 0.98
R6089:Cyp3a13 UTSW 5 137909953 missense probably benign 0.07
R6927:Cyp3a13 UTSW 5 137895284 missense probably damaging 1.00
R6978:Cyp3a13 UTSW 5 137905539 missense probably benign 0.01
R7283:Cyp3a13 UTSW 5 137905556 missense probably benign 0.01
R7571:Cyp3a13 UTSW 5 137898863 missense possibly damaging 0.93
R7781:Cyp3a13 UTSW 5 137898874 missense possibly damaging 0.94
RF007:Cyp3a13 UTSW 5 137894263 makesense probably null
RF020:Cyp3a13 UTSW 5 137894263 makesense probably null
X0024:Cyp3a13 UTSW 5 137900391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACAGTCCCTTCAGTCC -3'
(R):5'- GACATGTGAACTTACTACTGCTTCAT -3'

Sequencing Primer
(F):5'- ATGTTCCACAGCTAGCAGTG -3'
(R):5'- GAACTTACTACTGCTTCATACTCTG -3'
Posted On2014-08-25