Incidental Mutation 'R2048:Olfr441'
ID222213
Institutional Source Beutler Lab
Gene Symbol Olfr441
Ensembl Gene ENSMUSG00000094669
Gene Nameolfactory receptor 441
SynonymsMOR261-3, GA_x6K02T2P3E9-4442577-4441645
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43106369-43117803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43116378 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 212 (M212K)
Ref Sequence ENSEMBL: ENSMUSP00000150572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095954] [ENSMUST00000204092] [ENSMUST00000213649]
Predicted Effect probably benign
Transcript: ENSMUST00000095954
AA Change: M212K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093648
Gene: ENSMUSG00000094669
AA Change: M212K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204092
AA Change: M212K
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: M212K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213649
AA Change: M212K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Olfr441
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Olfr441 UTSW 6 43116624 missense probably null 0.04
R0528:Olfr441 UTSW 6 43116216 missense possibly damaging 0.56
R1441:Olfr441 UTSW 6 43115946 missense probably benign 0.02
R2191:Olfr441 UTSW 6 43116065 missense probably benign 0.13
R4438:Olfr441 UTSW 6 43116287 missense probably benign 0.09
R4465:Olfr441 UTSW 6 43115918 missense probably damaging 0.97
R5191:Olfr441 UTSW 6 43115866 missense probably damaging 1.00
R6353:Olfr441 UTSW 6 43116136 nonsense probably null
R6719:Olfr441 UTSW 6 43115973 missense probably damaging 1.00
Z1177:Olfr441 UTSW 6 43116235 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGGCTGCTGTCTCCTGG -3'
(R):5'- CAGGGAAAGGATCTTTTGCTG -3'

Sequencing Primer
(F):5'- GTCTCCTGGATAGTTGGCTTCC -3'
(R):5'- GAAAGGATCTTTTGCTGCATTTCAG -3'
Posted On2014-08-25