Incidental Mutation 'R1980:Vmn1r226'
ID222214
Institutional Source Beutler Lab
Gene Symbol Vmn1r226
Ensembl Gene ENSMUSG00000042848
Gene Namevomeronasal 1 receptor 226
SynonymsV1re2
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20687508-20688404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20688046 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 180 (M180K)
Ref Sequence ENSEMBL: ENSMUSP00000058266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061756
AA Change: M180K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058266
Gene: ENSMUSG00000042848
AA Change: M180K

DomainStartEndE-ValueType
Pfam:TAS2R 1 286 5.2e-12 PFAM
Pfam:7tm_1 22 285 9.1e-7 PFAM
Pfam:V1R 33 292 8.7e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Vmn1r226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Vmn1r226 APN 17 20687904 missense probably damaging 1.00
IGL02103:Vmn1r226 APN 17 20687664 missense probably damaging 0.98
IGL03394:Vmn1r226 APN 17 20688184 missense probably benign 0.00
R0243:Vmn1r226 UTSW 17 20687577 missense probably benign 0.00
R0605:Vmn1r226 UTSW 17 20687871 missense probably benign 0.12
R1463:Vmn1r226 UTSW 17 20687732 missense probably benign 0.00
R1571:Vmn1r226 UTSW 17 20688276 missense probably damaging 0.97
R1677:Vmn1r226 UTSW 17 20688073 missense probably damaging 1.00
R1917:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R1918:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R1919:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R2291:Vmn1r226 UTSW 17 20688213 missense probably damaging 1.00
R2377:Vmn1r226 UTSW 17 20687730 missense probably benign 0.05
R3878:Vmn1r226 UTSW 17 20687998 missense possibly damaging 0.79
R5166:Vmn1r226 UTSW 17 20687863 missense probably benign 0.43
R6510:Vmn1r226 UTSW 17 20687853 missense probably benign 0.37
R6599:Vmn1r226 UTSW 17 20688289 missense probably benign 0.01
R7304:Vmn1r226 UTSW 17 20687749 missense probably damaging 1.00
X0066:Vmn1r226 UTSW 17 20688250 missense probably damaging 0.99
Z1177:Vmn1r226 UTSW 17 20688217 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACCACCTGTTTCTTGAG -3'
(R):5'- ACCAGAGTCAAGATGTTGTGTG -3'

Sequencing Primer
(F):5'- GAGTGTCTTTCAAGCAATCACC -3'
(R):5'- AGTCAAGATGTTGTGTGTGGCTC -3'
Posted On2014-08-25