Incidental Mutation 'R1980:Olfr91'
ID 222216
Institutional Source Beutler Lab
Gene Symbol Olfr91
Ensembl Gene ENSMUSG00000095377
Gene Name olfactory receptor 91
Synonyms MOR256-20, GA_x6K02T2PSCP-1533927-1532989
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1980 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37090618-37098278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 37093403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 157 (Q157P)
Ref Sequence ENSEMBL: ENSMUSP00000150298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087144] [ENSMUST00000207101] [ENSMUST00000215195] [ENSMUST00000216376] [ENSMUST00000216488] [ENSMUST00000217372] [ENSMUST00000217397]
AlphaFold Q7TRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000087144
AA Change: Q157P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129446
Gene: ENSMUSG00000095377
AA Change: Q157P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 4.8e-7 PFAM
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207101
Predicted Effect probably benign
Transcript: ENSMUST00000215195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215502
Predicted Effect probably damaging
Transcript: ENSMUST00000216376
AA Change: Q157P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216488
Predicted Effect probably damaging
Transcript: ENSMUST00000217372
AA Change: Q157P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000217397
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Olfr91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Olfr91 APN 17 37093332 missense probably benign 0.00
IGL03352:Olfr91 APN 17 37093419 missense probably benign 0.06
R0506:Olfr91 UTSW 17 37093311 missense probably damaging 1.00
R1982:Olfr91 UTSW 17 37093808 missense probably damaging 0.98
R4941:Olfr91 UTSW 17 37093592 missense probably damaging 1.00
R5160:Olfr91 UTSW 17 37093724 missense possibly damaging 0.83
R5795:Olfr91 UTSW 17 37093769 missense probably damaging 1.00
R6484:Olfr91 UTSW 17 37093266 missense probably benign
R6710:Olfr91 UTSW 17 37093746 missense probably damaging 1.00
R6838:Olfr91 UTSW 17 37093166 nonsense probably null
R8439:Olfr91 UTSW 17 37093772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAATGGCTCCGTAAGAG -3'
(R):5'- AAAGACCATCAGCTTCCTGG -3'

Sequencing Primer
(F):5'- GCTCCGTAAGAGACAAGGATG -3'
(R):5'- ACCATCAGCTTCCTGGGATGC -3'
Posted On 2014-08-25