Incidental Mutation 'R2048:Zfp541'
ID222226
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Namezinc finger protein 541
SynonymsEG666528
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16061814-16096334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16078327 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 302 (R302G)
Ref Sequence ENSEMBL: ENSMUSP00000148143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108509
AA Change: R302G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: R302G

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209369
AA Change: R302G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210805
AA Change: R302G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 16079468 missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 16079695 missense probably damaging 1.00
IGL02347:Zfp541 APN 7 16083465 missense probably damaging 1.00
IGL02516:Zfp541 APN 7 16082993 splice site probably null
R0101:Zfp541 UTSW 7 16078043 missense probably damaging 1.00
R0412:Zfp541 UTSW 7 16082174 missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 16095682 splice site probably benign
R0784:Zfp541 UTSW 7 16082992 intron probably benign
R1083:Zfp541 UTSW 7 16078712 missense probably benign 0.16
R1541:Zfp541 UTSW 7 16078512 missense probably benign 0.04
R1575:Zfp541 UTSW 7 16078715 missense possibly damaging 0.94
R1730:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1783:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1966:Zfp541 UTSW 7 16079071 missense probably benign 0.02
R2022:Zfp541 UTSW 7 16082185 missense probably damaging 1.00
R2436:Zfp541 UTSW 7 16076448 missense possibly damaging 0.94
R3973:Zfp541 UTSW 7 16072222 missense probably damaging 1.00
R4081:Zfp541 UTSW 7 16072135 missense probably benign 0.16
R4589:Zfp541 UTSW 7 16083336 missense probably benign 0.35
R4724:Zfp541 UTSW 7 16081687 missense probably damaging 0.99
R4812:Zfp541 UTSW 7 16079110 missense probably benign 0.01
R4817:Zfp541 UTSW 7 16090382 missense probably damaging 1.00
R5232:Zfp541 UTSW 7 16095179 missense probably damaging 1.00
R5331:Zfp541 UTSW 7 16095758 missense probably damaging 1.00
R5551:Zfp541 UTSW 7 16090861 missense probably damaging 1.00
R5976:Zfp541 UTSW 7 16076419 missense probably benign 0.34
R6259:Zfp541 UTSW 7 16095526 missense probably benign 0.02
R6523:Zfp541 UTSW 7 16095520 missense probably damaging 1.00
R6826:Zfp541 UTSW 7 16078982 missense probably damaging 0.96
R7319:Zfp541 UTSW 7 16079369 missense probably benign 0.21
R7428:Zfp541 UTSW 7 16092868 missense probably damaging 1.00
R7594:Zfp541 UTSW 7 16076386 missense probably damaging 0.96
R7724:Zfp541 UTSW 7 16071994 missense probably damaging 1.00
Z1088:Zfp541 UTSW 7 16079795 missense probably benign 0.16
Z1176:Zfp541 UTSW 7 16078266 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16078763 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16079029 missense probably benign 0.26
Z1177:Zfp541 UTSW 7 16082167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAAGGAGACTCCACCAGAAG -3'
(R):5'- CAACTCTGACTCTGGTGGATCG -3'

Sequencing Primer
(F):5'- TCCACCAGAAGAGGAGGCC -3'
(R):5'- ATCGGGGACACCATTCTCAG -3'
Posted On2014-08-25