Incidental Mutation 'R1980:Dsg1a'
ID222229
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20338650 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 653 (N653I)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably damaging
Transcript: ENSMUST00000077146
AA Change: N653I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: N653I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Tyro3 A G 2: 119,808,817 D335G probably benign Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
PIT4687001:Dsg1a UTSW 18 20331698 missense probably benign 0.16
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
R7201:Dsg1a UTSW 18 20328311 missense probably damaging 0.98
R7730:Dsg1a UTSW 18 20331711 missense possibly damaging 0.77
R7814:Dsg1a UTSW 18 20338515 intron probably null
R8185:Dsg1a UTSW 18 20340612 missense probably damaging 1.00
R8297:Dsg1a UTSW 18 20332033 missense probably benign 0.02
R8377:Dsg1a UTSW 18 20333774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACACCACATAGAAAGGTC -3'
(R):5'- ACCTGGCAGAAGTAACTTTCC -3'

Sequencing Primer
(F):5'- GCAGATGATTAAAATTAGCAAGCTG -3'
(R):5'- GGCAGAAGTAACTTTCCATGAAATTC -3'
Posted On2014-08-25