Mutagenetix > Incidental Mutations

Incidental Mutation 'R2048:Otog'

222230

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

040055-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R2048 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46287639 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1591 (T1591S)

Ref Sequence

ENSEMBL: ENSMUSP00000130949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164538]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164538
AA Change: T1591S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: T1591S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	A	G	9: 70,740,075	D19G	possibly damaging	Het
Adhfe1	A	G	1: 9,563,553	K342R	probably benign	Het
Adk	A	G	14: 21,318,176	N223S	probably damaging	Het
Aff4	A	G	11: 53,398,385	S454G	probably benign	Het
Ahnak	T	A	19: 9,007,056	N1901K	probably damaging	Het
Camsap1	T	C	2: 25,929,743	T1578A	probably benign	Het
Ccdc63	A	C	5: 122,130,287		probably null	Het
Ceacam1	G	T	7: 25,476,688	S27Y	probably benign	Het
Cit	T	C	5: 115,886,813		probably null	Het
Cntn4	A	G	6: 106,437,864		probably benign	Het
Cyp2d26	A	G	15: 82,792,727		probably benign	Het
Cyp3a13	A	T	5: 137,909,975	V204E	probably damaging	Het
Cyp51	G	A	5: 4,086,636		probably benign	Het
Epb41l4b	T	G	4: 57,142,866	E96D	probably benign	Het
Epg5	A	G	18: 78,023,987	E2221G	probably damaging	Het
Fam69a	T	C	5: 107,910,020	D179G	probably damaging	Het
Fbxo21	T	A	5: 118,008,104	N597K	probably damaging	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fsip1	C	A	2: 118,241,716	E195D	probably damaging	Het
Gm10152	T	C	7: 144,763,312	F35L	unknown	Het
Gtpbp6	A	C	5: 110,107,065	V87G	probably damaging	Het
Hal	A	G	10: 93,491,140	T176A	probably damaging	Het
Il12rb2	G	T	6: 67,360,545	N117K	probably benign	Het
Kalrn	A	G	16: 34,252,310	V734A	probably benign	Het
Klf7	A	G	1: 64,078,754	V228A	possibly damaging	Het
Kng1	A	G	16: 23,058,604	Y54C	probably damaging	Het
Lpcat2	T	G	8: 92,869,843	N169K	possibly damaging	Het
Magohb	A	T	6: 131,289,422	S40R	probably damaging	Het
Mgam	A	G	6: 40,656,429	D186G	possibly damaging	Het
Mycbp2	A	G	14: 103,232,524		probably null	Het
Myh15	A	G	16: 49,155,565	D1332G	probably damaging	Het
Myh9	G	A	15: 77,771,132	T1208M	possibly damaging	Het
Ncor2	C	T	5: 125,084,932	R426H	unknown	Het
Nradd	T	C	9: 110,621,629	E160G	probably benign	Het
Olfr441	T	A	6: 43,116,378	M212K	probably benign	Het
Olfr819	G	A	10: 129,965,992	S230L	probably damaging	Het
Oxsr1	A	G	9: 119,247,074	S389P	probably benign	Het
Pde3a	A	G	6: 141,489,006		probably benign	Het
Pi4k2b	A	T	5: 52,748,431	I105L	probably benign	Het
Pilrb1	T	C	5: 137,854,891	R217G	possibly damaging	Het
Poteg	A	T	8: 27,456,746	I159L	probably benign	Het
Ppargc1a	A	G	5: 51,548,516	F75S	probably damaging	Het
Ptk2b	T	G	14: 66,172,505	D466A	probably benign	Het
Ptpn21	A	G	12: 98,689,526	V394A	possibly damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Shisa3	G	A	5: 67,611,308	E184K	possibly damaging	Het
Slc4a2	A	G	5: 24,431,559	H283R	probably damaging	Het
Slc9a3	A	G	13: 74,163,741	S603G	probably damaging	Het
Tas2r124	A	G	6: 132,754,895	I56V	possibly damaging	Het
Tbcd	G	T	11: 121,540,936	C470F	probably damaging	Het
Thsd1	A	G	8: 22,259,317	R674G	probably benign	Het
Zbtb11	T	A	16: 55,998,009	C599S	probably damaging	Het
Zfp541	A	G	7: 16,078,327	R302G	possibly damaging	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
BB010:Otog	UTSW	7	46310147	missense	probably damaging	1.00
BB020:Otog	UTSW	7	46310147	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0836:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1843:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5757:Otog	UTSW	7	46241121	critical splice donor site	probably null
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6454:Otog	UTSW	7	46305817	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7033:Otog	UTSW	7	46267398	critical splice donor site	probably null
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
R7806:Otog	UTSW	7	46285776	missense	probably benign
R7933:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R8021:Otog	UTSW	7	46267342	missense	probably damaging	0.98
R8082:Otog	UTSW	7	46289719	missense	probably damaging	1.00
R8531:Otog	UTSW	7	46252049	missense	probably damaging	0.99
RF024:Otog	UTSW	7	46287669	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46262852	missense	possibly damaging	0.80
Z1177:Otog	UTSW	7	46274538	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46289740	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46309985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCTTACAACATCTAACTTTCCTG -3'
(R):5'- TGCAGTTGACAGGTGGGATC -3'

Sequencing Primer
(F):5'- TTTCCTGCTGGCCACACAGAG -3'
(R):5'- CTCCAAGGGAAGTCATAGGTCTG -3'

Posted On

2014-08-25