Incidental Mutation 'R2048:Thsd1'
ID222237
Institutional Source Beutler Lab
Gene Symbol Thsd1
Ensembl Gene ENSMUSG00000031480
Gene Namethrombospondin, type I, domain 1
SynonymsTmtsp, 4833423O18Rik
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22227313-22261334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22259317 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 674 (R674G)
Ref Sequence ENSEMBL: ENSMUSP00000148214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069828] [ENSMUST00000160585] [ENSMUST00000162447]
Predicted Effect probably benign
Transcript: ENSMUST00000069828
AA Change: R735G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000067701
Gene: ENSMUSG00000031480
AA Change: R735G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 342 392 4.55e-8 SMART
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160585
AA Change: R682G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125118
Gene: ENSMUSG00000031480
AA Change: R682G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162447
AA Change: R674G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a type 1 thrombospondin domain, which is found in a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Thsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Thsd1 APN 8 22252231 missense probably damaging 1.00
IGL02288:Thsd1 APN 8 22259549 missense probably damaging 1.00
IGL02517:Thsd1 APN 8 22243438 missense probably damaging 1.00
IGL02591:Thsd1 APN 8 22258727 missense probably damaging 1.00
IGL03378:Thsd1 APN 8 22243778 missense probably benign 0.13
R0137:Thsd1 UTSW 8 22243039 missense probably damaging 1.00
R0507:Thsd1 UTSW 8 22258679 missense probably damaging 1.00
R0854:Thsd1 UTSW 8 22258571 missense probably damaging 0.99
R1109:Thsd1 UTSW 8 22243692 missense possibly damaging 0.93
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1899:Thsd1 UTSW 8 22252318 splice site probably benign
R1900:Thsd1 UTSW 8 22252318 splice site probably benign
R2008:Thsd1 UTSW 8 22259231 missense probably benign 0.23
R2090:Thsd1 UTSW 8 22259657 missense possibly damaging 0.95
R2165:Thsd1 UTSW 8 22238522 intron probably benign
R2209:Thsd1 UTSW 8 22258871 missense probably damaging 1.00
R3831:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3833:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3847:Thsd1 UTSW 8 22259411 missense probably damaging 0.97
R4049:Thsd1 UTSW 8 22243164 missense possibly damaging 0.75
R4454:Thsd1 UTSW 8 22243578 missense probably damaging 1.00
R4659:Thsd1 UTSW 8 22259298 nonsense probably null
R4997:Thsd1 UTSW 8 22243324 missense probably damaging 0.98
R6440:Thsd1 UTSW 8 22258553 missense possibly damaging 0.59
R6457:Thsd1 UTSW 8 22243347 missense probably damaging 0.97
R6488:Thsd1 UTSW 8 22243717 missense probably benign 0.36
R6519:Thsd1 UTSW 8 22259065 missense probably damaging 1.00
R7267:Thsd1 UTSW 8 22243581 missense probably benign 0.10
R7448:Thsd1 UTSW 8 22243333 missense possibly damaging 0.89
R7698:Thsd1 UTSW 8 22258987 nonsense probably null
R7733:Thsd1 UTSW 8 22258721 missense probably damaging 1.00
R7792:Thsd1 UTSW 8 22243098 missense probably damaging 0.99
R7894:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
R7977:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
X0023:Thsd1 UTSW 8 22259567 missense probably damaging 1.00
Z1088:Thsd1 UTSW 8 22252219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAACCAAGCAGTCTCG -3'
(R):5'- GGCTAAGCTGACTGACTTTCTG -3'

Sequencing Primer
(F):5'- GAGAGGAGTTTGTCAGCCC -3'
(R):5'- CTAAGCTGACTGACTTTCTGGTAGC -3'
Posted On2014-08-25