Incidental Mutation 'R2048:Lpcat2'
ID222243
Institutional Source Beutler Lab
Gene Symbol Lpcat2
Ensembl Gene ENSMUSG00000033192
Gene Namelysophosphatidylcholine acyltransferase 2
SynonymslysoPAFAT/LPCAT2, LPCAT2, Aytl1a, Aytl1
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location92855339-92919279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92869843 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 169 (N169K)
Ref Sequence ENSEMBL: ENSMUSP00000147941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046290] [ENSMUST00000209265] [ENSMUST00000210099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046290
AA Change: N169K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049252
Gene: ENSMUSG00000033192
AA Change: N169K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 35 45 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
PlsC 140 251 2.78e-22 SMART
Blast:PlsC 284 326 3e-19 BLAST
EFh 395 423 4.49e-4 SMART
EFh 432 460 6.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130471
Predicted Effect possibly damaging
Transcript: ENSMUST00000209265
AA Change: N169K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210099
AA Change: N169K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.4691 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Lpcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lpcat2 APN 8 92909206 missense probably damaging 1.00
IGL00823:Lpcat2 APN 8 92864970 missense possibly damaging 0.90
IGL00911:Lpcat2 APN 8 92890710 missense probably damaging 0.99
IGL01449:Lpcat2 APN 8 92871147 missense possibly damaging 0.69
IGL01951:Lpcat2 APN 8 92918047 missense probably damaging 1.00
IGL02041:Lpcat2 APN 8 92918181 missense probably benign 0.04
IGL02491:Lpcat2 APN 8 92874251 missense probably damaging 1.00
IGL02957:Lpcat2 APN 8 92875584 nonsense probably null
R0960:Lpcat2 UTSW 8 92869710 missense probably benign
R1236:Lpcat2 UTSW 8 92886569 missense probably damaging 1.00
R1422:Lpcat2 UTSW 8 92879417 missense probably damaging 1.00
R1677:Lpcat2 UTSW 8 92864932 missense probably benign 0.08
R3712:Lpcat2 UTSW 8 92918170 missense possibly damaging 0.70
R3919:Lpcat2 UTSW 8 92914274 missense probably damaging 0.99
R3951:Lpcat2 UTSW 8 92864903 missense probably benign
R4357:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4358:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4359:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4401:Lpcat2 UTSW 8 92873055 missense possibly damaging 0.61
R4584:Lpcat2 UTSW 8 92889371 missense probably damaging 1.00
R5089:Lpcat2 UTSW 8 92879443 missense probably damaging 1.00
R5127:Lpcat2 UTSW 8 92909191 missense possibly damaging 0.65
R5185:Lpcat2 UTSW 8 92869737 missense probably benign 0.04
R6380:Lpcat2 UTSW 8 92886581 missense probably benign
R6974:Lpcat2 UTSW 8 92873079 missense probably damaging 1.00
R7171:Lpcat2 UTSW 8 92909266 missense probably benign 0.00
R7344:Lpcat2 UTSW 8 92875567 missense probably damaging 0.98
R7356:Lpcat2 UTSW 8 92864983 missense probably benign
R7684:Lpcat2 UTSW 8 92909195 missense possibly damaging 0.91
R7834:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
R7917:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCTTTGACATTTCTGGCGCG -3'
(R):5'- GCAAAGTCTCCTGAAAGCCC -3'

Sequencing Primer
(F):5'- GCGCGTGCCATGTTCTTC -3'
(R):5'- AACTGGCTGGAGATATCATTCG -3'
Posted On2014-08-25