Incidental Mutation 'R2048:Adam10'
ID222246
Institutional Source Beutler Lab
Gene Symbol Adam10
Ensembl Gene ENSMUSG00000054693
Gene Namea disintegrin and metallopeptidase domain 10
Synonymskuzbanian, 1700031C13Rik, kuz
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70678997-70780229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70740075 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000116867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067880] [ENSMUST00000140205] [ENSMUST00000144537]
Predicted Effect probably benign
Transcript: ENSMUST00000067880
AA Change: N162S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000063839
Gene: ENSMUSG00000054693
AA Change: N162S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 27 156 7.5e-15 PFAM
Pfam:Reprolysin_5 219 434 1e-33 PFAM
Pfam:Reprolysin_4 219 453 2.1e-29 PFAM
Pfam:Reprolysin 221 457 6.1e-8 PFAM
Pfam:Reprolysin_2 240 447 6.5e-39 PFAM
Pfam:Reprolysin_3 244 395 4.6e-27 PFAM
DISIN 467 551 5.99e-23 SMART
transmembrane domain 675 697 N/A INTRINSIC
low complexity region 709 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140205
AA Change: N162S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117162
Gene: ENSMUSG00000054693
AA Change: N162S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 156 5.8e-18 PFAM
Pfam:Reprolysin_5 219 434 2.6e-34 PFAM
Pfam:Reprolysin_4 219 453 4e-30 PFAM
Pfam:Reprolysin 221 457 4.4e-10 PFAM
Pfam:Reprolysin_2 240 447 5.1e-36 PFAM
Pfam:Reprolysin_3 244 395 1.7e-24 PFAM
DISIN 467 513 1.48e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144537
AA Change: D19G

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116867
Gene: ENSMUSG00000054693
AA Change: D19G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Reprolysin_5 76 145 5.8e-9 PFAM
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system. [provided by RefSeq, May 2016]
PHENOTYPE: Targeted inactivation of this gene leads to embryonic lethality at E9.5. Embryos homozygous for a knock-out allele display decreased size and multiple abnormalities related to Notch signaling, including defects of the developing central nervous system, somites, and cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Adam10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Adam10 APN 9 70718746 missense possibly damaging 0.92
IGL00582:Adam10 APN 9 70766895 missense possibly damaging 0.54
IGL02021:Adam10 APN 9 70743909 missense possibly damaging 0.60
IGL02149:Adam10 APN 9 70703431 missense probably damaging 1.00
IGL03310:Adam10 APN 9 70778089 missense probably damaging 1.00
PIT4382001:Adam10 UTSW 9 70766081 missense probably damaging 1.00
R0110:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0469:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0510:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0555:Adam10 UTSW 9 70754234 missense probably damaging 1.00
R0671:Adam10 UTSW 9 70765941 splice site probably benign
R0735:Adam10 UTSW 9 70748251 missense possibly damaging 0.81
R0785:Adam10 UTSW 9 70767888 missense possibly damaging 0.86
R0881:Adam10 UTSW 9 70746237 missense probably damaging 1.00
R1019:Adam10 UTSW 9 70761640 missense probably benign 0.00
R1169:Adam10 UTSW 9 70746292 missense probably damaging 0.97
R1779:Adam10 UTSW 9 70776369 splice site probably benign
R2911:Adam10 UTSW 9 70718723 missense probably damaging 0.99
R3890:Adam10 UTSW 9 70768854 missense probably benign 0.00
R4608:Adam10 UTSW 9 70743891 missense probably damaging 0.99
R4609:Adam10 UTSW 9 70740143 missense probably damaging 1.00
R4689:Adam10 UTSW 9 70765954 missense possibly damaging 0.51
R5135:Adam10 UTSW 9 70766074 missense probably damaging 1.00
R5496:Adam10 UTSW 9 70722739 missense probably damaging 1.00
R5499:Adam10 UTSW 9 70740117 missense probably benign 0.16
R6730:Adam10 UTSW 9 70740176 critical splice donor site probably null
R6825:Adam10 UTSW 9 70761602 missense probably damaging 1.00
R6987:Adam10 UTSW 9 70722696 missense probably benign
R7616:Adam10 UTSW 9 70722711 missense possibly damaging 0.81
R7829:Adam10 UTSW 9 70766927 nonsense probably null
R7908:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
R7989:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
X0020:Adam10 UTSW 9 70740143 missense probably damaging 1.00
X0064:Adam10 UTSW 9 70765952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATAGTGTCTTTCTCGTGAATG -3'
(R):5'- CACAACTCCTAGAACATATGTGTG -3'

Sequencing Primer
(F):5'- ATTGGATGGATCCCCTGGAAC -3'
(R):5'- TGTGTGAAATGAAGAAACACTTGCCC -3'
Posted On2014-08-25