Incidental Mutation 'R2048:Oxsr1'
ID222249
Institutional Source Beutler Lab
Gene Symbol Oxsr1
Ensembl Gene ENSMUSG00000036737
Gene Nameoxidative-stress responsive 1
Synonyms2210022N24Rik, Osr1, 2810422B09Rik
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119238432-119322427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119247074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000042155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040853] [ENSMUST00000128880] [ENSMUST00000143728] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000040853
AA Change: S389P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042155
Gene: ENSMUSG00000036737
AA Change: S389P

DomainStartEndE-ValueType
S_TKc 17 291 1.45e-84 SMART
low complexity region 332 350 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
Pfam:OSR1_C 434 465 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128880
SMART Domains Protein: ENSMUSP00000122692
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 100 6.3e-13 PFAM
Pfam:Pkinase 17 111 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136902
Predicted Effect probably benign
Transcript: ENSMUST00000143728
SMART Domains Protein: ENSMUSP00000117327
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
PDB:2VWI|D 1 32 2e-14 PDB
SCOP:d1f3mc_ 1 33 1e-7 SMART
low complexity region 61 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Oxsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Oxsr1 APN 9 119259211 missense probably damaging 1.00
IGL01380:Oxsr1 APN 9 119260101 intron probably benign
IGL02542:Oxsr1 APN 9 119242735 missense possibly damaging 0.67
IGL02806:Oxsr1 APN 9 119241194 missense possibly damaging 0.55
R0629:Oxsr1 UTSW 9 119241784 intron probably benign
R2094:Oxsr1 UTSW 9 119294494 missense probably benign 0.22
R2159:Oxsr1 UTSW 9 119304814 missense possibly damaging 0.52
R2165:Oxsr1 UTSW 9 119294432 missense probably damaging 1.00
R3905:Oxsr1 UTSW 9 119247112 missense probably benign
R6017:Oxsr1 UTSW 9 119264777 missense probably benign 0.00
R6286:Oxsr1 UTSW 9 119264882 missense probably damaging 0.99
R6899:Oxsr1 UTSW 9 119247122 missense probably benign 0.00
R7091:Oxsr1 UTSW 9 119284661 missense probably benign 0.03
R7683:Oxsr1 UTSW 9 119241755 missense probably benign 0.30
R7715:Oxsr1 UTSW 9 119242756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAAAGTATCAATGGGCATGAC -3'
(R):5'- CTCGACTACCTAGCAAGTTGC -3'

Sequencing Primer
(F):5'- TCAATGGGCATGACTACTGTTC -3'
(R):5'- GCAAGTTGCAGACCAGCCTC -3'
Posted On2014-08-25