Incidental Mutation 'R2048:Tbcd'
ID222257
Institutional Source Beutler Lab
Gene Symbol Tbcd
Ensembl Gene ENSMUSG00000039230
Gene Nametubulin-specific chaperone d
Synonyms2310057L06Rik, A030005L14Rik
MMRRC Submission 040055-MU
Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121451949-121617164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121540936 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 470 (C470F)
Ref Sequence ENSEMBL: ENSMUSP00000099302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103013]
Predicted Effect probably damaging
Transcript: ENSMUST00000103013
AA Change: C470F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230
AA Change: C470F

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125167
SMART Domains Protein: ENSMUSP00000124735
Gene: ENSMUSG00000039230

DomainStartEndE-ValueType
low complexity region 36 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147560
Meta Mutation Damage Score 0.9525 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Tbcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Tbcd APN 11 121575321 missense probably damaging 0.96
IGL00795:Tbcd APN 11 121616932 missense probably benign
IGL00802:Tbcd APN 11 121608610 missense possibly damaging 0.55
IGL01286:Tbcd APN 11 121493893 critical splice donor site probably null
IGL01325:Tbcd APN 11 121540993 missense probably damaging 0.99
IGL01348:Tbcd APN 11 121497076 missense probably benign
IGL01432:Tbcd APN 11 121475680 splice site probably benign
IGL01577:Tbcd APN 11 121497012 missense probably damaging 1.00
IGL01660:Tbcd APN 11 121605327 missense probably benign 0.01
IGL01865:Tbcd APN 11 121590380 missense possibly damaging 0.81
IGL02260:Tbcd APN 11 121603278 missense probably damaging 1.00
IGL02492:Tbcd APN 11 121497134 missense probably benign 0.06
IGL02620:Tbcd APN 11 121461255 missense probably damaging 1.00
IGL02950:Tbcd APN 11 121603709 missense probably damaging 0.99
R6859_Tbcd_818 UTSW 11 121497111 missense possibly damaging 0.81
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0077:Tbcd UTSW 11 121594274 missense probably benign 0.00
R0349:Tbcd UTSW 11 121602983 splice site probably null
R0865:Tbcd UTSW 11 121602989 missense possibly damaging 0.88
R1203:Tbcd UTSW 11 121475625 missense probably benign 0.00
R1221:Tbcd UTSW 11 121497083 missense probably benign 0.00
R1549:Tbcd UTSW 11 121560753 missense probably benign
R1586:Tbcd UTSW 11 121497060 missense probably benign 0.13
R1671:Tbcd UTSW 11 121597294 missense probably benign 0.00
R2051:Tbcd UTSW 11 121453670 missense probably damaging 1.00
R2124:Tbcd UTSW 11 121603320 missense probably damaging 1.00
R2151:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R2153:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R3120:Tbcd UTSW 11 121608648 missense probably damaging 0.97
R4108:Tbcd UTSW 11 121493811 missense probably benign 0.00
R4244:Tbcd UTSW 11 121594281 missense probably damaging 1.00
R4587:Tbcd UTSW 11 121605271 missense possibly damaging 0.75
R4684:Tbcd UTSW 11 121493771 missense probably damaging 1.00
R4837:Tbcd UTSW 11 121582785 critical splice donor site probably null
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4960:Tbcd UTSW 11 121573855 missense probably benign 0.03
R5157:Tbcd UTSW 11 121610027 missense probably benign 0.14
R5166:Tbcd UTSW 11 121609390 missense possibly damaging 0.87
R5403:Tbcd UTSW 11 121560743 missense probably damaging 0.99
R5406:Tbcd UTSW 11 121452101 missense probably benign
R5509:Tbcd UTSW 11 121602012 missense probably benign 0.00
R5767:Tbcd UTSW 11 121592692 missense probably benign 0.00
R5923:Tbcd UTSW 11 121580152 missense probably benign
R5966:Tbcd UTSW 11 121601911 intron probably benign
R6330:Tbcd UTSW 11 121497086 missense probably benign
R6539:Tbcd UTSW 11 121556987 critical splice donor site probably null
R6852:Tbcd UTSW 11 121609380 missense probably benign 0.36
R6859:Tbcd UTSW 11 121497111 missense possibly damaging 0.81
R7348:Tbcd UTSW 11 121594311 missense probably benign 0.22
R7479:Tbcd UTSW 11 121492605 critical splice donor site probably null
R7679:Tbcd UTSW 11 121603708 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGGGCTTGCTTCCCTTTCAG -3'
(R):5'- GCAGCTAGTTGTAGAGAATGGC -3'

Sequencing Primer
(F):5'- TGTTTTGTTTTGTTTTTCCTGAGCAG -3'
(R):5'- CAGCTAGTTGTAGAGAATGGCTTACC -3'
Posted On2014-08-25