Incidental Mutation 'R2048:Zbtb11'
ID222285
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Namezinc finger and BTB domain containing 11
SynonymsZNF-U69274, 9230110G02Rik
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55973883-56008913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55998009 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 599 (C599S)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
Predicted Effect probably damaging
Transcript: ENSMUST00000050248
AA Change: C599S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: C599S

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Meta Mutation Damage Score 0.9639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55998193 nonsense probably null
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1437:Zbtb11 UTSW 16 55991620 critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2925:Zbtb11 UTSW 16 55974084 missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55990491 missense probably benign 0.03
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
R7194:Zbtb11 UTSW 16 56007188 missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55990487 missense probably benign 0.01
R8022:Zbtb11 UTSW 16 56006020 missense probably damaging 0.99
RF014:Zbtb11 UTSW 16 55980597 missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55991502 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTGTTTCATATACCCTTGGCTG -3'
(R):5'- TACACCCGTGTGCTTTAGC -3'

Sequencing Primer
(F):5'- CATATACCCTTGGCTGTGTTTTGCG -3'
(R):5'- TGTATGCGGAGAGAGTATAATTTAGG -3'
Posted On2014-08-25