Incidental Mutation 'R2013:Olfr1143'
ID222302
Institutional Source Beutler Lab
Gene Symbol Olfr1143
Ensembl Gene ENSMUSG00000068815
Gene Nameolfactory receptor 1143
SynonymsGA_x6K02T2Q125-49303473-49304405, MOR177-14
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87800592-87804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87802503 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 38 (V38G)
Ref Sequence ENSEMBL: ENSMUSP00000088210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090708] [ENSMUST00000099852] [ENSMUST00000111568]
Predicted Effect probably damaging
Transcript: ENSMUST00000090708
AA Change: V38G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088210
Gene: ENSMUSG00000068815
AA Change: V38G

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.6e-45 PFAM
Pfam:7tm_1 45 294 5.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099852
AA Change: V34G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: V34G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111568
AA Change: V34G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107194
Gene: ENSMUSG00000068815
AA Change: V34G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-44 PFAM
Pfam:7tm_1 41 290 2.8e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Olfr1143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Olfr1143 APN 2 87803200 nonsense probably null
IGL01670:Olfr1143 APN 2 87802880 missense probably benign 0.10
IGL02503:Olfr1143 APN 2 87802520 missense probably benign 0.01
R0316:Olfr1143 UTSW 2 87803181 missense probably damaging 0.98
R1381:Olfr1143 UTSW 2 87803136 missense probably damaging 1.00
R1496:Olfr1143 UTSW 2 87802868 missense probably benign 0.00
R1753:Olfr1143 UTSW 2 87802762 missense probably benign 0.06
R2370:Olfr1143 UTSW 2 87802815 missense probably benign 0.35
R3810:Olfr1143 UTSW 2 87803052 missense possibly damaging 0.90
R3812:Olfr1143 UTSW 2 87803052 missense possibly damaging 0.90
R3909:Olfr1143 UTSW 2 87802687 missense probably benign
R4227:Olfr1143 UTSW 2 87802875 missense probably damaging 0.97
R5753:Olfr1143 UTSW 2 87803252 missense probably benign 0.05
R6516:Olfr1143 UTSW 2 87802770 missense possibly damaging 0.81
Z1177:Olfr1143 UTSW 2 87803228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGATATCCAGAAGGCAATACC -3'
(R):5'- TACCGGTCAAAGGCCATCAC -3'

Sequencing Primer
(F):5'- GGCAATACCTATATTTCCCATTCTC -3'
(R):5'- GTCAAAGGCCATCACTGCCAG -3'
Posted On2014-08-25