Incidental Mutation 'R0140:Arhgap15'
ID22234
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene NameRho GTPase activating protein 15
Synonyms
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location43748824-44395953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44322767 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 416 (F416L)
Ref Sequence ENSEMBL: ENSMUSP00000108443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
Predicted Effect probably damaging
Transcript: ENSMUST00000055776
AA Change: F416L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: F416L

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112824
AA Change: F416L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: F416L

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
9330161L09Rik T C 12: 103,407,328 probably benign Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Blnk A T 19: 40,940,224 S285T probably damaging Het
Calr3 C T 8: 72,434,888 probably benign Het
Camsap2 A T 1: 136,280,382 V1124D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y437C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 probably benign Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 probably benign Het
Lepr A T 4: 101,768,067 D473V probably damaging Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 probably benign Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 probably benign Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr1261 T A 2: 89,994,119 V242D probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr628 A G 7: 103,732,142 D72G probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Pxdn A G 12: 29,982,754 E179G probably benign Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 probably benign Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 probably benign Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P88S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 probably benign Het
Vav2 C T 2: 27,273,676 probably benign Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44243153 missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 44065045 missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43780755 missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 44063808 missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 44063837 missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44116662 missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44142350 critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43780736 missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44243131 missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 44063766 missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44116617 missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44116717 critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44142295 missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44243124 missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44386347 missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 44063786 missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43748890 start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44142341 missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43844813 critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44322755 missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R5202:Arhgap15 UTSW 2 44063857 missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43828760 missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44322727 missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44116677 missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 44063774 missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43780636 missense probably benign 0.01
R7658:Arhgap15 UTSW 2 44142268 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTCAGTTCCTAACGTGAGCACACC -3'
(R):5'- AGCCCTCAGAAGTTCCCTTCTTGG -3'

Sequencing Primer
(F):5'- GCTCTCCTTAAGTGAGCTAGAAAC -3'
(R):5'- AGAAGTTCCCTTCTTGGTTCTC -3'
Posted On2013-04-16