Mutagenetix > Incidental Mutation

Incidental Mutation 'R1981:Myo9a'

222340

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

039993-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1981 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59894146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1876 (T1876A)

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: T1805A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: T1805A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298
AA Change: T1876A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: T1876A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: T1876A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: T1876A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atad1	G	T	19: 32,695,810	D224E	probably benign	Het
Atp1a3	T	G	7: 25,000,975	E33A	probably benign	Het
Baz2b	A	G	2: 59,923,680	F1100L	possibly damaging	Het
Car7	C	T	8: 104,548,377		probably benign	Het
Casp8	C	A	1: 58,828,962		probably null	Het
Cdh23	A	T	10: 60,378,751	L1495H	probably damaging	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Col16a1	C	G	4: 130,065,443	P346A	unknown	Het
Cyp2c29	A	G	19: 39,307,772		probably null	Het
Cyp3a13	T	C	5: 137,911,856	S139G	probably damaging	Het
Dapk2	A	G	9: 66,268,898	H327R	probably benign	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dnah2	A	G	11: 69,474,325	Y1944H	probably damaging	Het
Dnaic2	T	A	11: 114,732,929	V6E	probably damaging	Het
Eipr1	T	C	12: 28,863,025	Y242H	probably damaging	Het
Fam149a	T	G	8: 45,381,741	D7A	probably damaging	Het
Fam217a	T	A	13: 34,916,754	D140V	probably benign	Het
Fat4	G	A	3: 38,991,664	C3944Y	probably damaging	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Gcsam	A	T	16: 45,619,974	T127S	probably damaging	Het
Git2	C	T	5: 114,749,559		probably benign	Het
Gm1527	T	C	3: 28,915,835		probably null	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gtf3c1	A	G	7: 125,644,272	L1720P	possibly damaging	Het
Hat1	A	G	2: 71,389,977	T28A	probably benign	Het
Igf2r	G	A	17: 12,733,903	Q219*	probably null	Het
Impdh1	T	A	6: 29,206,451	D129V	possibly damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Ltbp3	A	G	19: 5,758,079	Q1250R	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mast2	T	C	4: 116,314,840	Y569C	probably damaging	Het
Mcoln3	A	T	3: 146,140,590	K552*	probably null	Het
Mctp2	T	C	7: 72,164,698	Q601R	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Myo19	A	T	11: 84,892,170	Q170L	possibly damaging	Het
Myo1h	T	C	5: 114,353,837	F676S	probably damaging	Het
Nav3	G	T	10: 109,719,090		probably benign	Het
Ndor1	T	C	2: 25,255,224	Y43C	probably damaging	Het
Nlrp1a	A	G	11: 71,098,938	V1102A	probably damaging	Het
Nmnat3	T	C	9: 98,410,299	I199T	possibly damaging	Het
Nsun7	T	C	5: 66,261,214	S96P	probably damaging	Het
Ntng1	A	G	3: 109,935,010	V149A	possibly damaging	Het
Oas3	T	C	5: 120,761,835		probably benign	Het
Olfr1055	A	T	2: 86,347,142	I208N	possibly damaging	Het
Olfr1297	T	A	2: 111,621,241	I278F	probably benign	Het
Olfr1350	A	G	7: 6,570,558	D189G	probably benign	Het
Olfr1418	T	G	19: 11,855,007	Q315H	possibly damaging	Het
Olfr147	T	C	9: 38,403,735	L287P	probably damaging	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Pax2	G	A	19: 44,818,465	D301N	probably damaging	Het
Pcsk4	T	A	10: 80,325,779	E176V	probably damaging	Het
Pkhd1	G	A	1: 20,117,060	P3675S	probably benign	Het
Plekho2	A	T	9: 65,558,692	L138Q	probably damaging	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr11	T	A	11: 87,103,290	D100V	probably damaging	Het
Qars	A	G	9: 108,515,028	N136D	probably damaging	Het
Rbm15b	A	G	9: 106,881,623		probably benign	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rsrc1	A	G	3: 67,350,005	D250G	probably benign	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Scn2a	C	A	2: 65,690,170	N503K	probably damaging	Het
Sh2d6	G	A	6: 72,517,544		probably benign	Het
Smg8	T	C	11: 87,085,331	T475A	probably benign	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Tbx20	T	A	9: 24,770,913	K48N	possibly damaging	Het
Tead1	C	A	7: 112,891,745	D231E	probably benign	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tjp1	A	T	7: 65,312,855	F1111L	probably damaging	Het
Tlr11	T	A	14: 50,361,988	I477K	possibly damaging	Het
Ttc13	A	G	8: 124,714,187		probably null	Het
Ttc17	T	C	2: 94,326,704	N411S	probably benign	Het
Usp15	T	A	10: 123,125,041		probably benign	Het
Usp18	A	G	6: 121,252,517	K32E	probably benign	Het
Vmn1r12	A	T	6: 57,159,661	M248L	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp930	T	A	8: 69,228,172	L172H	probably damaging	Het
Zfp976	G	A	7: 42,613,622	H264Y	probably damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
R9498:Myo9a	UTSW	9	59827183	missense	probably damaging	1.00
R9575:Myo9a	UTSW	9	59905907	missense	probably damaging	1.00
R9651:Myo9a	UTSW	9	59871481	missense	probably damaging	0.96
R9672:Myo9a	UTSW	9	59780049	missense	probably benign	0.16
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCAACTTGACTCCCTAAC -3'
(R):5'- GGCACTTGCTATGATTTGGAC -3'

Sequencing Primer
(F):5'- CTTGACTCCCTAACAAGTTGTTAAC -3'
(R):5'- GGACAGAGTCATTTTGCCAATGC -3'

Posted On

2014-08-25