Incidental Mutation 'R1981:Qars'
ID222353
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Nameglutaminyl-tRNA synthetase
Synonyms1110018N24Rik, 1200016L19Rik
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108507706-108515941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108515028 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 136 (N136D)
Ref Sequence ENSEMBL: ENSMUSP00000146774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000006851] [ENSMUST00000112155] [ENSMUST00000134939] [ENSMUST00000192819] [ENSMUST00000192932] [ENSMUST00000193258] [ENSMUST00000193348] [ENSMUST00000194045] [ENSMUST00000194385] [ENSMUST00000195513] [ENSMUST00000195563] [ENSMUST00000207790] [ENSMUST00000207810] [ENSMUST00000207862] [ENSMUST00000207947] [ENSMUST00000208162] [ENSMUST00000208177] [ENSMUST00000208214] [ENSMUST00000208581]
Predicted Effect probably damaging
Transcript: ENSMUST00000006838
AA Change: N716D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604
AA Change: N716D

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131005
Predicted Effect unknown
Transcript: ENSMUST00000134939
AA Change: N692D
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604
AA Change: N692D

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141780
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192659
Predicted Effect probably benign
Transcript: ENSMUST00000192819
SMART Domains Protein: ENSMUSP00000142027
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 85 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192932
SMART Domains Protein: ENSMUSP00000141215
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193258
SMART Domains Protein: ENSMUSP00000141267
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193348
SMART Domains Protein: ENSMUSP00000141691
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 80 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194045
Predicted Effect probably benign
Transcript: ENSMUST00000194385
SMART Domains Protein: ENSMUSP00000142211
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1cy5a_ 9 45 8e-3 SMART
low complexity region 79 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194743
Predicted Effect probably benign
Transcript: ENSMUST00000195513
SMART Domains Protein: ENSMUSP00000142025
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195563
SMART Domains Protein: ENSMUSP00000141716
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207126
Predicted Effect unknown
Transcript: ENSMUST00000207180
AA Change: N131D
Predicted Effect probably benign
Transcript: ENSMUST00000207713
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect probably benign
Transcript: ENSMUST00000207810
Predicted Effect probably benign
Transcript: ENSMUST00000207862
Predicted Effect probably benign
Transcript: ENSMUST00000207947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208069
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect probably damaging
Transcript: ENSMUST00000208177
AA Change: N136D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect unknown
Transcript: ENSMUST00000208506
AA Change: N157D
Predicted Effect probably benign
Transcript: ENSMUST00000208581
Predicted Effect probably benign
Transcript: ENSMUST00000208962
Meta Mutation Damage Score 0.7556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R0576:Qars UTSW 9 108514962 intron probably benign
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 unclassified probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R2172:Qars UTSW 9 108509200 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5234:Qars UTSW 9 108514165 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R5817:Qars UTSW 9 108510242 unclassified probably benign
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGCCTCTATGAGTGCCTG -3'
(R):5'- ATAGGTGGGTCAAATTAAGCACC -3'

Sequencing Primer
(F):5'- TGCCTGTGAGTGAACATAGC -3'
(R):5'- GTGGGTCAAATTAAGCACCTGTCC -3'
Posted On2014-08-25