Incidental Mutation 'R0140:Olfr1261'
ID22236
Institutional Source Beutler Lab
Gene Symbol Olfr1261
Ensembl Gene ENSMUSG00000061295
Gene Nameolfactory receptor 1261
SynonymsGA_x6K02T2Q125-51425355-51426275, MOR234-3
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location89991221-89996189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89994119 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 242 (V242D)
Ref Sequence ENSEMBL: ENSMUSP00000150711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077785] [ENSMUST00000111509] [ENSMUST00000213909] [ENSMUST00000216953]
Predicted Effect probably damaging
Transcript: ENSMUST00000077785
AA Change: V242D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076959
Gene: ENSMUSG00000061295
AA Change: V242D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-26 PFAM
Pfam:7tm_4 134 275 4.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111509
SMART Domains Protein: ENSMUSP00000107134
Gene: ENSMUSG00000061295

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.8e-41 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213909
AA Change: V242D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216953
AA Change: V242D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
9330161L09Rik T C 12: 103,407,328 probably benign Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgap15 C A 2: 44,322,767 F416L probably damaging Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Blnk A T 19: 40,940,224 S285T probably damaging Het
Calr3 C T 8: 72,434,888 probably benign Het
Camsap2 A T 1: 136,280,382 V1124D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y437C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 probably benign Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 probably benign Het
Lepr A T 4: 101,768,067 D473V probably damaging Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 probably benign Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 probably benign Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr628 A G 7: 103,732,142 D72G probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Pxdn A G 12: 29,982,754 E179G probably benign Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 probably benign Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 probably benign Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P88S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 probably benign Het
Vav2 C T 2: 27,273,676 probably benign Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Olfr1261
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Olfr1261 APN 2 89994312 missense probably benign 0.00
R0220:Olfr1261 UTSW 2 89993862 missense probably benign 0.08
R0243:Olfr1261 UTSW 2 89993806 missense probably benign 0.01
R1644:Olfr1261 UTSW 2 89993953 missense possibly damaging 0.60
R1669:Olfr1261 UTSW 2 89993800 splice site probably null
R1916:Olfr1261 UTSW 2 89993804 missense probably benign
R3620:Olfr1261 UTSW 2 89993852 missense probably damaging 1.00
R4190:Olfr1261 UTSW 2 89993574 nonsense probably null
R5260:Olfr1261 UTSW 2 89994182 missense probably damaging 1.00
R5591:Olfr1261 UTSW 2 89993407 missense possibly damaging 0.95
R5907:Olfr1261 UTSW 2 89993957 missense probably benign 0.01
R5910:Olfr1261 UTSW 2 89993438 missense probably benign 0.29
R6044:Olfr1261 UTSW 2 89993417 missense possibly damaging 0.89
R6556:Olfr1261 UTSW 2 89994173 missense probably benign 0.39
R7083:Olfr1261 UTSW 2 89993857 missense probably benign
R7439:Olfr1261 UTSW 2 89993839 missense probably benign 0.00
R8439:Olfr1261 UTSW 2 89994004 missense probably benign 0.31
R8745:Olfr1261 UTSW 2 89993732 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTACATGACCATCATGAACCG -3'
(R):5'- AGCTTTCCTCATTCGACCCCAGAG -3'

Sequencing Primer
(F):5'- ATGAACCGACCTCTGTGTG -3'
(R):5'- GACCCCAGAGCTTCTTCATAAC -3'
Posted On2013-04-16