Mutagenetix > Incidental Mutations

Incidental Mutation 'R1981:Nav3'

222361

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

039993-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1981 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 109719090 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably benign
Transcript: ENSMUST00000032719

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161582

SMART Domains

Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
low complexity region	84	95	N/A	INTRINSIC
low complexity region	150	173	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	354	372	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	551	562	N/A	INTRINSIC
low complexity region	570	589	N/A	INTRINSIC
low complexity region	604	618	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
coiled coil region	842	933	N/A	INTRINSIC
low complexity region	952	969	N/A	INTRINSIC
low complexity region	992	1003	N/A	INTRINSIC
low complexity region	1026	1051	N/A	INTRINSIC
low complexity region	1052	1065	N/A	INTRINSIC
coiled coil region	1071	1112	N/A	INTRINSIC
low complexity region	1118	1141	N/A	INTRINSIC
AAA	1299	1454	4.94e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atad1	G	T	19: 32,695,810	D224E	probably benign	Het
Atp1a3	T	G	7: 25,000,975	E33A	probably benign	Het
Baz2b	A	G	2: 59,923,680	F1100L	possibly damaging	Het
Car7	C	T	8: 104,548,377		probably benign	Het
Casp8	C	A	1: 58,828,962		probably null	Het
Cdh23	A	T	10: 60,378,751	L1495H	probably damaging	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Col16a1	C	G	4: 130,065,443	P346A	unknown	Het
Cyp2c29	A	G	19: 39,307,772		probably null	Het
Cyp3a13	T	C	5: 137,911,856	S139G	probably damaging	Het
Dapk2	A	G	9: 66,268,898	H327R	probably benign	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dnah2	A	G	11: 69,474,325	Y1944H	probably damaging	Het
Dnaic2	T	A	11: 114,732,929	V6E	probably damaging	Het
Eipr1	T	C	12: 28,863,025	Y242H	probably damaging	Het
Fam149a	T	G	8: 45,381,741	D7A	probably damaging	Het
Fam217a	T	A	13: 34,916,754	D140V	probably benign	Het
Fat4	G	A	3: 38,991,664	C3944Y	probably damaging	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Gcsam	A	T	16: 45,619,974	T127S	probably damaging	Het
Git2	C	T	5: 114,749,559		probably benign	Het
Gm1527	T	C	3: 28,915,835		probably null	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gtf3c1	A	G	7: 125,644,272	L1720P	possibly damaging	Het
Hat1	A	G	2: 71,389,977	T28A	probably benign	Het
Igf2r	G	A	17: 12,733,903	Q219*	probably null	Het
Impdh1	T	A	6: 29,206,451	D129V	possibly damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Ltbp3	A	G	19: 5,758,079	Q1250R	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mast2	T	C	4: 116,314,840	Y569C	probably damaging	Het
Mcoln3	A	T	3: 146,140,590	K552*	probably null	Het
Mctp2	T	C	7: 72,164,698	Q601R	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Myo19	A	T	11: 84,892,170	Q170L	possibly damaging	Het
Myo1h	T	C	5: 114,353,837	F676S	probably damaging	Het
Myo9a	A	G	9: 59,894,146	T1876A	probably benign	Het
Ndor1	T	C	2: 25,255,224	Y43C	probably damaging	Het
Nlrp1a	A	G	11: 71,098,938	V1102A	probably damaging	Het
Nmnat3	T	C	9: 98,410,299	I199T	possibly damaging	Het
Nsun7	T	C	5: 66,261,214	S96P	probably damaging	Het
Ntng1	A	G	3: 109,935,010	V149A	possibly damaging	Het
Oas3	T	C	5: 120,761,835		probably benign	Het
Olfr1055	A	T	2: 86,347,142	I208N	possibly damaging	Het
Olfr1297	T	A	2: 111,621,241	I278F	probably benign	Het
Olfr1350	A	G	7: 6,570,558	D189G	probably benign	Het
Olfr1418	T	G	19: 11,855,007	Q315H	possibly damaging	Het
Olfr147	T	C	9: 38,403,735	L287P	probably damaging	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Pax2	G	A	19: 44,818,465	D301N	probably damaging	Het
Pcsk4	T	A	10: 80,325,779	E176V	probably damaging	Het
Pkhd1	G	A	1: 20,117,060	P3675S	probably benign	Het
Plekho2	A	T	9: 65,558,692	L138Q	probably damaging	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr11	T	A	11: 87,103,290	D100V	probably damaging	Het
Qars	A	G	9: 108,515,028	N136D	probably damaging	Het
Rbm15b	A	G	9: 106,881,623		probably benign	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rsrc1	A	G	3: 67,350,005	D250G	probably benign	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Scn2a	C	A	2: 65,690,170	N503K	probably damaging	Het
Sh2d6	G	A	6: 72,517,544		probably benign	Het
Smg8	T	C	11: 87,085,331	T475A	probably benign	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Tbx20	T	A	9: 24,770,913	K48N	possibly damaging	Het
Tead1	C	A	7: 112,891,745	D231E	probably benign	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tjp1	A	T	7: 65,312,855	F1111L	probably damaging	Het
Tlr11	T	A	14: 50,361,988	I477K	possibly damaging	Het
Ttc13	A	G	8: 124,714,187		probably null	Het
Ttc17	T	C	2: 94,326,704	N411S	possibly damaging	Het
Usp15	T	A	10: 123,125,041		probably benign	Het
Usp18	A	G	6: 121,252,517	K32E	probably benign	Het
Vmn1r12	A	T	6: 57,159,661	M248L	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp930	T	A	8: 69,228,172	L172H	probably damaging	Het
Zfp976	G	A	7: 42,613,622	H264Y	probably damaging	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATTGGTACCCCTACAGCTC -3'
(R):5'- CCTTGGATGAAACCCAAAGC -3'

Sequencing Primer
(F):5'- CCCTACAGCTCTATTCAGAAAGTG -3'
(R):5'- CCAAAGCTAGCGAAGACTTTTACTGG -3'

Posted On

2014-08-25