Incidental Mutation 'R2013:Myo16'
ID222366
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 040022-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10502796 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 945 (F945I)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: F945I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: F945I

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: F889I
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: F945I
Meta Mutation Damage Score 0.3993 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7319:Myo16 UTSW 8 10476185 synonymous probably null
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
R7498:Myo16 UTSW 8 10400589 missense unknown
R7539:Myo16 UTSW 8 10361095 critical splice donor site probably null
R7622:Myo16 UTSW 8 10376238 missense unknown
R7794:Myo16 UTSW 8 10569913 missense unknown
R7903:Myo16 UTSW 8 10376265 missense probably null
R8055:Myo16 UTSW 8 10562186 missense unknown
R8078:Myo16 UTSW 8 10562078 missense unknown
R8081:Myo16 UTSW 8 10322743 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Z1177:Myo16 UTSW 8 10474691 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGAGTCACTGTCTGTCTGG -3'
(R):5'- TGCCCGAGCAGAGTAAAGAC -3'

Sequencing Primer
(F):5'- GAGTCACTGTCTGTCTGGAAAAC -3'
(R):5'- CCCGAGCAGAGTAAAGACAACAG -3'
Posted On2014-08-25