Incidental Mutation 'R2013:Scn10a'
ID222380
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R2013 (G1)
Quality Score148
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119613736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1481 (I1481N)
Ref Sequence ENSEMBL: ENSMUSP00000148987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably benign
Transcript: ENSMUST00000084787
AA Change: I1482N

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: I1482N

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213392
AA Change: I1481N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000214408
AA Change: I1482N

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGTTGGTGAAGTAATACTGCC -3'
(R):5'- ACAGCCTGGCCTGAGATTTC -3'

Sequencing Primer
(F):5'- CGAAGGGCGAACATCTTCATC -3'
(R):5'- CTGGCCTGAGATTTCCTTCTC -3'
Posted On2014-08-25