Mutagenetix > Incidental Mutation

Incidental Mutation 'R1981:Aqp4'

222409

Institutional Source

Beutler Lab

Gene Symbol

Aqp4

Ensembl Gene

ENSMUSG00000024411

Gene Name

aquaporin 4

Synonyms

aquaporin-4

MMRRC Submission

039993-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R1981 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15389394-15403684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15393551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 291 (D291G)

Ref Sequence

ENSEMBL: ENSMUSP00000078088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079081]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000079081
AA Change: D291G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: D291G

Domain	Start	End	E-Value	Type
Pfam:MIP	29	248	8.7e-76	PFAM

Meta Mutation Damage Score

0.1057

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Atad1	G	T	19: 32,695,810	D224E	probably benign	Het
Atp1a3	T	G	7: 25,000,975	E33A	probably benign	Het
Baz2b	A	G	2: 59,923,680	F1100L	possibly damaging	Het
Car7	C	T	8: 104,548,377		probably benign	Het
Casp8	C	A	1: 58,828,962		probably null	Het
Cdh23	A	T	10: 60,378,751	L1495H	probably damaging	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Col16a1	C	G	4: 130,065,443	P346A	unknown	Het
Cyp2c29	A	G	19: 39,307,772		probably null	Het
Cyp3a13	T	C	5: 137,911,856	S139G	probably damaging	Het
Dapk2	A	G	9: 66,268,898	H327R	probably benign	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dnah2	A	G	11: 69,474,325	Y1944H	probably damaging	Het
Dnaic2	T	A	11: 114,732,929	V6E	probably damaging	Het
Eipr1	T	C	12: 28,863,025	Y242H	probably damaging	Het
Fam149a	T	G	8: 45,381,741	D7A	probably damaging	Het
Fam217a	T	A	13: 34,916,754	D140V	probably benign	Het
Fat4	G	A	3: 38,991,664	C3944Y	probably damaging	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Gcsam	A	T	16: 45,619,974	T127S	probably damaging	Het
Git2	C	T	5: 114,749,559		probably benign	Het
Gm1527	T	C	3: 28,915,835		probably null	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gtf3c1	A	G	7: 125,644,272	L1720P	possibly damaging	Het
Hat1	A	G	2: 71,389,977	T28A	probably benign	Het
Igf2r	G	A	17: 12,733,903	Q219*	probably null	Het
Impdh1	T	A	6: 29,206,451	D129V	possibly damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Ltbp3	A	G	19: 5,758,079	Q1250R	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mast2	T	C	4: 116,314,840	Y569C	probably damaging	Het
Mcoln3	A	T	3: 146,140,590	K552*	probably null	Het
Mctp2	T	C	7: 72,164,698	Q601R	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Myo19	A	T	11: 84,892,170	Q170L	possibly damaging	Het
Myo1h	T	C	5: 114,353,837	F676S	probably damaging	Het
Myo9a	A	G	9: 59,894,146	T1876A	probably benign	Het
Nav3	G	T	10: 109,719,090		probably benign	Het
Ndor1	T	C	2: 25,255,224	Y43C	probably damaging	Het
Nlrp1a	A	G	11: 71,098,938	V1102A	probably damaging	Het
Nmnat3	T	C	9: 98,410,299	I199T	possibly damaging	Het
Nsun7	T	C	5: 66,261,214	S96P	probably damaging	Het
Ntng1	A	G	3: 109,935,010	V149A	possibly damaging	Het
Oas3	T	C	5: 120,761,835		probably benign	Het
Olfr1055	A	T	2: 86,347,142	I208N	possibly damaging	Het
Olfr1297	T	A	2: 111,621,241	I278F	probably benign	Het
Olfr1350	A	G	7: 6,570,558	D189G	probably benign	Het
Olfr1418	T	G	19: 11,855,007	Q315H	possibly damaging	Het
Olfr147	T	C	9: 38,403,735	L287P	probably damaging	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Pax2	G	A	19: 44,818,465	D301N	probably damaging	Het
Pcsk4	T	A	10: 80,325,779	E176V	probably damaging	Het
Pkhd1	G	A	1: 20,117,060	P3675S	probably benign	Het
Plekho2	A	T	9: 65,558,692	L138Q	probably damaging	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr11	T	A	11: 87,103,290	D100V	probably damaging	Het
Qars	A	G	9: 108,515,028	N136D	probably damaging	Het
Rbm15b	A	G	9: 106,881,623		probably benign	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rsrc1	A	G	3: 67,350,005	D250G	probably benign	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Scn2a	C	A	2: 65,690,170	N503K	probably damaging	Het
Sh2d6	G	A	6: 72,517,544		probably benign	Het
Smg8	T	C	11: 87,085,331	T475A	probably benign	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Tbx20	T	A	9: 24,770,913	K48N	possibly damaging	Het
Tead1	C	A	7: 112,891,745	D231E	probably benign	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tjp1	A	T	7: 65,312,855	F1111L	probably damaging	Het
Tlr11	T	A	14: 50,361,988	I477K	possibly damaging	Het
Ttc13	A	G	8: 124,714,187		probably null	Het
Ttc17	T	C	2: 94,326,704	N411S	probably benign	Het
Usp15	T	A	10: 123,125,041		probably benign	Het
Usp18	A	G	6: 121,252,517	K32E	probably benign	Het
Vmn1r12	A	T	6: 57,159,661	M248L	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp930	T	A	8: 69,228,172	L172H	probably damaging	Het
Zfp976	G	A	7: 42,613,622	H264Y	probably damaging	Het

Other mutations in Aqp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Aqp4	APN	18	15393599	missense	probably benign	0.01
IGL01700:Aqp4	APN	18	15399865	missense	probably benign	0.44
IGL02409:Aqp4	APN	18	15399725	missense	probably benign	0.02
IGL02812:Aqp4	APN	18	15397575	splice site	probably null
IGL03157:Aqp4	APN	18	15399980	missense	probably benign	0.18
IGL03196:Aqp4	APN	18	15393509	missense	probably benign	0.19
R0358:Aqp4	UTSW	18	15398245	missense	probably benign
R1061:Aqp4	UTSW	18	15398191	missense	probably damaging	1.00
R1982:Aqp4	UTSW	18	15393551	missense	probably damaging	0.98
R2274:Aqp4	UTSW	18	15393480	missense	probably benign
R3033:Aqp4	UTSW	18	15393560	missense	possibly damaging	0.80
R4608:Aqp4	UTSW	18	15398126	missense	probably benign	0.25
R4817:Aqp4	UTSW	18	15399758	missense	probably damaging	1.00
R4882:Aqp4	UTSW	18	15398254	missense	possibly damaging	0.73
R5870:Aqp4	UTSW	18	15399889	missense	probably damaging	1.00
R6235:Aqp4	UTSW	18	15398113	missense	probably damaging	1.00
R6334:Aqp4	UTSW	18	15393591	missense	probably benign
R6856:Aqp4	UTSW	18	15399896	missense	possibly damaging	0.88
R7753:Aqp4	UTSW	18	15399976	missense	probably benign	0.00
R7839:Aqp4	UTSW	18	15399680	missense	possibly damaging	0.51
R8191:Aqp4	UTSW	18	15398165	missense	probably benign
R8206:Aqp4	UTSW	18	15393659	missense	possibly damaging	0.88
R8759:Aqp4	UTSW	18	15399991	missense	probably benign
R9614:Aqp4	UTSW	18	15393630	missense	probably benign	0.01
T0970:Aqp4	UTSW	18	15399883	missense	probably damaging	1.00
Z1177:Aqp4	UTSW	18	15399881	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCAAGAAACCCGCAAGTGTC -3'
(R):5'- CCTTCTCCTCAGATATATTGGGTTGG -3'

Sequencing Primer
(F):5'- ACAAATCTGTTTCCTTAATGGGTGGC -3'
(R):5'- CTTAAGGAAGCCTTCAGC -3'

Posted On

2014-08-25