Mutagenetix > Incidental Mutation

Incidental Mutation 'R0140:Celsr2'

22242

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

038425-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0140 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108397933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 2110 (R2110K)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090558
AA Change: R2110K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: R2110K

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133216

Predicted Effect

unknown
Transcript: ENSMUST00000147251
AA Change: R98K

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: R98K

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147565

SMART Domains

Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
EGF	13	46	8e-5	SMART
LamG	72	206	1.56e-24	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
9330161L09Rik	T	C	12: 103,407,328		probably benign	Het
Abca2	T	G	2: 25,438,085		probably null	Het
Adgrf3	T	C	5: 30,196,381	K13R	probably benign	Het
Arhgap15	C	A	2: 44,322,767	F416L	probably damaging	Het
Arhgef26	C	G	3: 62,448,245	T746R	probably benign	Het
Aspm	C	T	1: 139,480,641	T2422I	probably benign	Het
Atp4a	C	G	7: 30,720,101	R659G	probably benign	Het
AY358078	T	A	14: 51,825,942	D348E	probably benign	Het
Blnk	A	T	19: 40,940,224	S285T	probably damaging	Het
Calr3	C	T	8: 72,434,888		probably benign	Het
Camsap2	A	T	1: 136,280,382	V1124D	probably benign	Het
Ccdc40	G	A	11: 119,264,299	G1122S	probably benign	Het
Ccdc69	C	A	11: 55,050,499	C196F	possibly damaging	Het
Cdhr3	T	G	12: 33,080,413	N141T	probably benign	Het
Cdk4	T	C	10: 127,064,345	V37A	probably damaging	Het
Clcn7	A	G	17: 25,153,754	Y437C	probably damaging	Het
Col6a6	A	G	9: 105,702,275	F1917S	probably damaging	Het
Cps1	T	G	1: 67,180,116	S872A	probably benign	Het
Crebbp	G	T	16: 4,117,499	T842N	probably damaging	Het
Dennd2d	G	A	3: 106,492,483	V234I	probably benign	Het
Fam227b	T	C	2: 126,124,603	M130V	possibly damaging	Het
Fbxw24	G	T	9: 109,605,414	L373I	possibly damaging	Het
Fubp3	T	C	2: 31,608,184	Y359H	probably damaging	Het
Gm19684	T	C	17: 36,127,427		probably benign	Het
Hrnr	C	T	3: 93,331,493	Q3013*	probably null	Het
Il12rb1	T	C	8: 70,819,771		probably benign	Het
Lepr	A	T	4: 101,768,067	D473V	probably damaging	Het
Myof	A	T	19: 37,951,556	Y820*	probably null	Het
Nfil3	G	A	13: 52,967,645	Q408*	probably null	Het
Nolc1	G	A	19: 46,081,378		probably benign	Het
Npbwr1	A	C	1: 5,916,621	Y225D	probably damaging	Het
Nrip3	T	C	7: 109,761,815		probably benign	Het
Ntrk1	A	C	3: 87,778,568	L749R	probably damaging	Het
Olfr1115	A	G	2: 87,252,625	I229M	probably damaging	Het
Olfr1261	T	A	2: 89,994,119	V242D	probably damaging	Het
Olfr222	A	G	11: 59,570,978	L254P	probably damaging	Het
Olfr628	A	G	7: 103,732,142	D72G	probably damaging	Het
Olfr801	G	T	10: 129,669,688	T277N	probably damaging	Het
Paox	A	T	7: 140,134,058	T244S	probably damaging	Het
Pcdhb9	T	A	18: 37,402,961	D669E	possibly damaging	Het
Pggt1b	A	G	18: 46,258,083		probably null	Het
Phkg1	T	A	5: 129,864,608	I334F	probably benign	Het
Phtf1	A	T	3: 103,987,560	R208W	probably null	Het
Pnliprp2	A	T	19: 58,766,363	I280F	probably benign	Het
Pnmal1	A	G	7: 16,960,222	M1V	probably null	Het
Prcp	A	G	7: 92,928,611	T328A	probably damaging	Het
Pxdn	A	G	12: 29,982,754	E179G	probably benign	Het
Racgap1	A	T	15: 99,623,651	N541K	probably benign	Het
Rnf103	T	A	6: 71,509,331	F315L	possibly damaging	Het
Sept2	A	G	1: 93,501,639	R237G	probably damaging	Het
Setd6	T	A	8: 95,716,109	L58Q	probably damaging	Het
Sipa1l1	G	A	12: 82,396,200	V755I	probably damaging	Het
Slc16a12	G	T	19: 34,672,704		probably benign	Het
Slk	G	A	19: 47,622,335	D815N	probably damaging	Het
Stx1a	T	C	5: 135,045,585		probably benign	Het
Tbc1d15	T	A	10: 115,220,219	I283F	probably damaging	Het
Tenm4	T	C	7: 96,896,052	I2425T	possibly damaging	Het
Tle1	G	A	4: 72,120,185	H702Y	probably damaging	Het
Tmc6	A	G	11: 117,766,251		probably benign	Het
Tmem268	G	A	4: 63,577,859	R179H	possibly damaging	Het
Tmem9	A	G	1: 136,034,162	K165R	probably damaging	Het
Trpm6	A	G	19: 18,819,194		probably null	Het
Tufm	C	T	7: 126,489,831	P88S	probably damaging	Het
Ubqln1	A	G	13: 58,193,289	I216T	probably damaging	Het
Urad	T	G	5: 147,322,331	M1L	probably benign	Het
Utp6	A	G	11: 79,956,725		probably benign	Het
Vav2	C	T	2: 27,273,676		probably benign	Het
Vmn2r55	G	T	7: 12,668,177	Q395K	possibly damaging	Het
Wwox	T	G	8: 114,706,287	V231G	probably damaging	Het
Zfp646	T	A	7: 127,883,506	N1618K	probably benign	Het
Zzef1	G	A	11: 72,899,551	M2110I	possibly damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATCCAGGCGCACTACAGAGATGAC -3'
(R):5'- TACACAAGGCTTCCCAGGAGAGAC -3'

Sequencing Primer
(F):5'- ACGGTGGCCCTTTGAAAC -3'
(R):5'- AGACTGTGGGGACTGCTG -3'

Posted On

2013-04-16