Incidental Mutation 'R2013:Cdk13'
ID222420
Institutional Source Beutler Lab
Gene Symbol Cdk13
Ensembl Gene ENSMUSG00000041297
Gene Namecyclin-dependent kinase 13
Synonyms2310015O17Rik, Cdc2l5
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location17710315-17805097 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17739163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 877 (L877*)
Ref Sequence ENSEMBL: ENSMUSP00000152820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042365] [ENSMUST00000222800] [ENSMUST00000223490]
Predicted Effect probably null
Transcript: ENSMUST00000042365
AA Change: L877*
SMART Domains Protein: ENSMUSP00000036013
Gene: ENSMUSG00000041297
AA Change: L877*

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 32 86 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
low complexity region 189 225 N/A INTRINSIC
low complexity region 238 272 N/A INTRINSIC
low complexity region 337 377 N/A INTRINSIC
low complexity region 384 402 N/A INTRINSIC
low complexity region 405 442 N/A INTRINSIC
low complexity region 450 490 N/A INTRINSIC
internal_repeat_1 553 599 6.15e-5 PROSPERO
low complexity region 607 617 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
S_TKc 705 998 7.25e-94 SMART
low complexity region 1173 1184 N/A INTRINSIC
internal_repeat_1 1190 1236 6.15e-5 PROSPERO
low complexity region 1248 1273 N/A INTRINSIC
low complexity region 1299 1311 N/A INTRINSIC
low complexity region 1355 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222359
Predicted Effect probably null
Transcript: ENSMUST00000222800
AA Change: L263*
Predicted Effect probably null
Transcript: ENSMUST00000223490
AA Change: L877*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Cdk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Cdk13 APN 13 17721098 missense possibly damaging 0.88
IGL00800:Cdk13 APN 13 17728142 missense probably damaging 1.00
IGL02186:Cdk13 APN 13 17772527 missense probably benign 0.02
IGL02447:Cdk13 APN 13 17772416 missense probably benign 0.10
IGL02494:Cdk13 APN 13 17739125 nonsense probably null
IGL02542:Cdk13 APN 13 17728178 missense probably damaging 0.99
IGL02602:Cdk13 APN 13 17727160 missense probably damaging 0.99
Vortex UTSW 13 17739154 missense probably damaging 1.00
Whirlpool UTSW 13 17772403 missense possibly damaging 0.92
R0115:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0421:Cdk13 UTSW 13 17763170 missense probably damaging 0.99
R0481:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0681:Cdk13 UTSW 13 17721297 splice site probably benign
R1432:Cdk13 UTSW 13 17718416 missense probably damaging 1.00
R2221:Cdk13 UTSW 13 17719535 missense probably damaging 0.99
R2332:Cdk13 UTSW 13 17718695 missense probably damaging 1.00
R2389:Cdk13 UTSW 13 17751776 missense probably damaging 1.00
R4546:Cdk13 UTSW 13 17766574 missense probably damaging 0.98
R4753:Cdk13 UTSW 13 17763248 missense probably damaging 1.00
R4855:Cdk13 UTSW 13 17721283 missense probably damaging 1.00
R4856:Cdk13 UTSW 13 17719734 missense probably benign
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4886:Cdk13 UTSW 13 17719734 missense probably benign
R4909:Cdk13 UTSW 13 17772403 missense possibly damaging 0.92
R5152:Cdk13 UTSW 13 17718525 missense probably benign 0.13
R5308:Cdk13 UTSW 13 17772313 missense probably damaging 0.98
R5350:Cdk13 UTSW 13 17803930 unclassified probably benign
R5412:Cdk13 UTSW 13 17766530 missense probably damaging 1.00
R5493:Cdk13 UTSW 13 17803562 unclassified probably benign
R5719:Cdk13 UTSW 13 17719655 missense probably damaging 0.98
R6052:Cdk13 UTSW 13 17721215 missense probably damaging 1.00
R6349:Cdk13 UTSW 13 17751719 missense probably damaging 1.00
R6415:Cdk13 UTSW 13 17739154 missense probably damaging 1.00
R7665:Cdk13 UTSW 13 17772553 missense possibly damaging 0.78
R7666:Cdk13 UTSW 13 17772576 start gained probably benign
R7764:Cdk13 UTSW 13 17721305 splice site probably null
RF009:Cdk13 UTSW 13 17803744 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCTAGCTGTGCAAGTTCCTG -3'
(R):5'- GCCCATGCATTGTATGATTGTG -3'

Sequencing Primer
(F):5'- TGAAGAGTTCACCAAGGATACATC -3'
(R):5'- CCCCTTTTCTGAGAAGGAGGAAAC -3'
Posted On2014-08-25