Incidental Mutation 'R0140:Lepr'
ID22245
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101768067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 473 (D473V)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably damaging
Transcript: ENSMUST00000037552
AA Change: D473V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: D473V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102777
AA Change: D473V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: D473V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106921
AA Change: D473V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: D473V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156402
Meta Mutation Damage Score 0.1847 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
9330161L09Rik T C 12: 103,407,328 probably benign Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgap15 C A 2: 44,322,767 F416L probably damaging Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Blnk A T 19: 40,940,224 S285T probably damaging Het
Calr3 C T 8: 72,434,888 probably benign Het
Camsap2 A T 1: 136,280,382 V1124D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y437C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 probably benign Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 probably benign Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 probably benign Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 probably benign Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr1261 T A 2: 89,994,119 V242D probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr628 A G 7: 103,732,142 D72G probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Pxdn A G 12: 29,982,754 E179G probably benign Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 probably benign Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 probably benign Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P88S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 probably benign Het
Vav2 C T 2: 27,273,676 probably benign Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
aufsetzigen UTSW 4 101752175 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
lowleaning UTSW 4 101814391 splice site probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
R0140_Lepr_245 UTSW 4 101768067 missense probably damaging 1.00
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 splice site probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
R8022:Lepr UTSW 4 101782557 missense probably benign 0.32
R8142:Lepr UTSW 4 101765419 missense possibly damaging 0.93
R8227:Lepr UTSW 4 101771362 missense probably damaging 0.99
R8426:Lepr UTSW 4 101814644 missense probably benign 0.12
R8447:Lepr UTSW 4 101814491 missense probably benign 0.08
R8531:Lepr UTSW 4 101765415 missense probably damaging 1.00
R8682:Lepr UTSW 4 101792072 missense probably benign 0.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101745614 missense probably damaging 0.99
Z1177:Lepr UTSW 4 101735595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTCCTGACATGGAAGGAAAGC -3'
(R):5'- TTGGTGGCGAGTCAAGTGAACC -3'

Sequencing Primer
(F):5'- gggtcgcagcaataggaag -3'
(R):5'- CCTAAAGAATGGTTGATCCTGATCC -3'
Posted On2013-04-16