Incidental Mutation 'R2007:Angptl3'
ID 222469
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Name angiopoietin-like 3
Synonyms hypl
MMRRC Submission 040016-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R2007 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98919191-98926429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98925634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 320 (I320T)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold Q9R182
Predicted Effect probably damaging
Transcript: ENSMUST00000030280
AA Change: I320T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: I320T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Meta Mutation Damage Score 0.4610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,519,855 (GRCm39) N1387K probably benign Het
Abca13 T C 11: 9,141,987 (GRCm39) F8L probably benign Het
Abcg5 G T 17: 84,977,348 (GRCm39) L270M probably damaging Het
Acad10 A G 5: 121,772,814 (GRCm39) L489S probably damaging Het
Acsf2 G A 11: 94,462,466 (GRCm39) T183I possibly damaging Het
Adamts7 A T 9: 90,059,909 (GRCm39) E282V probably damaging Het
Adcy4 C T 14: 56,015,770 (GRCm39) G440R possibly damaging Het
AI429214 G A 8: 37,460,923 (GRCm39) V24I probably benign Het
Apoa5 A T 9: 46,181,665 (GRCm39) Q247L possibly damaging Het
Astn1 T G 1: 158,436,875 (GRCm39) V811G probably damaging Het
Bard1 C T 1: 71,070,562 (GRCm39) V641I probably benign Het
Calb2 T C 8: 110,894,702 (GRCm39) E23G probably benign Het
Cdkl4 A G 17: 80,863,730 (GRCm39) probably benign Het
Cep85l A G 10: 53,154,171 (GRCm39) probably benign Het
Cfap91 T C 16: 38,118,616 (GRCm39) I728V probably benign Het
Chd1 G T 17: 15,951,268 (GRCm39) G281V probably damaging Het
Col17a1 C T 19: 47,656,141 (GRCm39) G586E probably damaging Het
Cpne3 T A 4: 19,553,833 (GRCm39) D66V probably damaging Het
Csde1 A T 3: 102,952,107 (GRCm39) I204L probably damaging Het
Dchs1 A T 7: 105,404,532 (GRCm39) V2670E probably damaging Het
Ddx10 A G 9: 53,124,578 (GRCm39) V428A probably benign Het
Dgkh T A 14: 78,840,489 (GRCm39) D530V probably benign Het
Dis3l A T 9: 64,215,558 (GRCm39) probably null Het
Dst T G 1: 34,265,093 (GRCm39) probably benign Het
Eml6 C T 11: 29,798,814 (GRCm39) probably null Het
En1 A T 1: 120,531,133 (GRCm39) E124D probably benign Het
Exo1 G A 1: 175,736,096 (GRCm39) E827K probably damaging Het
Fktn T C 4: 53,735,099 (GRCm39) F246L possibly damaging Het
Fndc1 G A 17: 7,997,580 (GRCm39) probably benign Het
Foxp2 G A 6: 15,396,818 (GRCm39) C381Y probably damaging Het
Galnt6 A T 15: 100,595,047 (GRCm39) Y485N probably damaging Het
Gemin4 G A 11: 76,103,444 (GRCm39) A439V possibly damaging Het
Gpatch8 A G 11: 102,391,657 (GRCm39) I155T unknown Het
Hmcn2 A G 2: 31,328,267 (GRCm39) D4316G possibly damaging Het
Hnrnpr T A 4: 136,046,824 (GRCm39) probably benign Het
Hpx G A 7: 105,244,781 (GRCm39) R135C probably damaging Het
Khdrbs2 T G 1: 32,559,629 (GRCm39) E151A probably benign Het
Krt6b A T 15: 101,586,562 (GRCm39) L309H probably damaging Het
Lce1c G T 3: 92,587,765 (GRCm39) C64F unknown Het
Marchf6 C T 15: 31,462,087 (GRCm39) probably null Het
Myt1 C A 2: 181,437,552 (GRCm39) R88S probably benign Het
Nemp1 A G 10: 127,529,446 (GRCm39) S194G probably benign Het
Nphp4 A G 4: 152,639,111 (GRCm39) K914R probably damaging Het
Or3a1 T A 11: 74,225,212 (GRCm39) T282S possibly damaging Het
Osbp T C 19: 11,951,265 (GRCm39) M270T probably benign Het
Parg T C 14: 31,932,531 (GRCm39) M457T possibly damaging Het
Phf20 T C 2: 156,129,874 (GRCm39) M482T probably benign Het
Pik3c2a G A 7: 115,941,472 (GRCm39) T1598I probably damaging Het
Pkd1 T C 17: 24,798,759 (GRCm39) M2689T probably damaging Het
Plxnd1 A T 6: 115,944,216 (GRCm39) V1091E probably damaging Het
Ptcd2 A T 13: 99,456,744 (GRCm39) L360Q probably damaging Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Serpinc1 A T 1: 160,821,110 (GRCm39) T65S probably benign Het
Sipa1l2 G A 8: 126,166,176 (GRCm39) T1486I probably damaging Het
Snrnp200 T C 2: 127,068,968 (GRCm39) L949P probably damaging Het
Ssc5d T G 7: 4,931,628 (GRCm39) C278W probably damaging Het
Tbc1d14 T G 5: 36,728,718 (GRCm39) H216P possibly damaging Het
Tmem183a A G 1: 134,277,861 (GRCm39) F301S probably damaging Het
Tmem233 A C 5: 116,189,496 (GRCm39) N94K possibly damaging Het
Tmprss13 A G 9: 45,243,843 (GRCm39) D193G probably damaging Het
Tprkb T C 6: 85,910,030 (GRCm39) probably benign Het
Tram1l1 A G 3: 124,115,488 (GRCm39) H216R possibly damaging Het
Ttn A G 2: 76,564,484 (GRCm39) V28551A probably damaging Het
Ubtfl1 A G 9: 18,320,547 (GRCm39) N25S possibly damaging Het
Unc80 C A 1: 66,542,935 (GRCm39) N396K probably damaging Het
Vmn1r171 T C 7: 23,332,012 (GRCm39) L79P probably damaging Het
Vmn2r115 G T 17: 23,566,927 (GRCm39) V480F possibly damaging Het
Xpo4 T C 14: 57,824,101 (GRCm39) I995V probably null Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 98,923,077 (GRCm39) missense probably damaging 0.99
IGL01859:Angptl3 APN 4 98,925,669 (GRCm39) nonsense probably null
IGL02126:Angptl3 APN 4 98,919,738 (GRCm39) critical splice donor site probably null
IGL02134:Angptl3 APN 4 98,919,349 (GRCm39) missense probably damaging 1.00
IGL02573:Angptl3 APN 4 98,926,171 (GRCm39) missense probably damaging 1.00
IGL02756:Angptl3 APN 4 98,919,399 (GRCm39) missense probably damaging 1.00
IGL03369:Angptl3 APN 4 98,923,057 (GRCm39) intron probably benign
R0309:Angptl3 UTSW 4 98,922,706 (GRCm39) missense probably benign 0.32
R0549:Angptl3 UTSW 4 98,919,692 (GRCm39) missense probably benign 0.00
R0675:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1738:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R2656:Angptl3 UTSW 4 98,926,201 (GRCm39) missense probably benign 0.01
R3436:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3437:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3615:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R3616:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R4161:Angptl3 UTSW 4 98,919,728 (GRCm39) missense probably damaging 0.99
R4534:Angptl3 UTSW 4 98,926,232 (GRCm39) missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 98,919,598 (GRCm39) missense probably benign 0.03
R4835:Angptl3 UTSW 4 98,925,649 (GRCm39) missense probably benign 0.36
R5308:Angptl3 UTSW 4 98,922,723 (GRCm39) missense probably benign 0.33
R5413:Angptl3 UTSW 4 98,919,259 (GRCm39) missense probably benign 0.12
R5668:Angptl3 UTSW 4 98,920,321 (GRCm39) critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 98,925,804 (GRCm39) missense probably benign 0.07
R6520:Angptl3 UTSW 4 98,926,085 (GRCm39) missense probably benign 0.35
R6544:Angptl3 UTSW 4 98,919,675 (GRCm39) missense probably damaging 1.00
R6762:Angptl3 UTSW 4 98,925,654 (GRCm39) missense possibly damaging 0.91
R7889:Angptl3 UTSW 4 98,919,308 (GRCm39) missense probably benign 0.00
R8305:Angptl3 UTSW 4 98,919,548 (GRCm39) missense probably damaging 1.00
R8690:Angptl3 UTSW 4 98,925,759 (GRCm39) missense probably benign 0.00
R9284:Angptl3 UTSW 4 98,919,480 (GRCm39) missense probably benign 0.00
Z1088:Angptl3 UTSW 4 98,922,757 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTATTAGCATTGCAAGCACAC -3'
(R):5'- ACATCAGGTCTGTGTGCTCTG -3'

Sequencing Primer
(F):5'- CTTGTAATCACAGCACTTCGGTAGG -3'
(R):5'- TGTGCTCTGGGAGGGCC -3'
Posted On 2014-08-25