Incidental Mutation 'R2007:Foxp2'
ID222483
Institutional Source Beutler Lab
Gene Symbol Foxp2
Ensembl Gene ENSMUSG00000029563
Gene Nameforkhead box P2
SynonymsD0Kist7, 2810043D05Rik
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location14901349-15441977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15396819 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 381 (C381Y)
Ref Sequence ENSEMBL: ENSMUSP00000111134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031545] [ENSMUST00000115469] [ENSMUST00000115472] [ENSMUST00000115474] [ENSMUST00000115475] [ENSMUST00000115477] [ENSMUST00000131414] [ENSMUST00000137628]
Predicted Effect unknown
Transcript: ENSMUST00000031545
AA Change: C356Y
SMART Domains Protein: ENSMUSP00000031545
Gene: ENSMUSG00000029563
AA Change: C356Y

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115469
AA Change: C355Y
SMART Domains Protein: ENSMUSP00000111129
Gene: ENSMUSG00000029563
AA Change: C355Y

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 48 68 N/A INTRINSIC
coiled coil region 139 214 N/A INTRINSIC
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 344 369 3.02e0 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115472
AA Change: C335Y
SMART Domains Protein: ENSMUSP00000111132
Gene: ENSMUSG00000029563
AA Change: C335Y

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 116 194 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
ZnF_C2H2 324 349 3.02e0 SMART
low complexity region 416 437 N/A INTRINSIC
FH 480 561 7.5e-37 SMART
low complexity region 584 603 N/A INTRINSIC
low complexity region 676 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115474
AA Change: C381Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111134
Gene: ENSMUSG00000029563
AA Change: C381Y

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 462 483 N/A INTRINSIC
FH 526 607 7.5e-37 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 722 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115475
SMART Domains Protein: ENSMUSP00000111135
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 8 46 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115477
AA Change: C356Y
SMART Domains Protein: ENSMUSP00000111137
Gene: ENSMUSG00000029563
AA Change: C356Y

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131414
AA Change: C381Y
SMART Domains Protein: ENSMUSP00000123007
Gene: ENSMUSG00000029563
AA Change: C381Y

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 437 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137628
SMART Domains Protein: ENSMUSP00000116650
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 95 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151301
SMART Domains Protein: ENSMUSP00000114735
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 48 68 N/A INTRINSIC
coiled coil region 139 214 N/A INTRINSIC
low complexity region 290 303 N/A INTRINSIC
Blast:ZnF_C2H2 344 363 8e-8 BLAST
Meta Mutation Damage Score 0.7766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, growth retardation, reduced vocalization, prolonged external granule cell layer presence, abnormal Purkinje and radial glial cells, delayed eye opening and ear emergence, negative geotaxis, impaired righting response, and hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Foxp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Foxp2 APN 6 15403819 missense probably damaging 1.00
IGL01011:Foxp2 APN 6 15438019 makesense probably null
IGL01412:Foxp2 APN 6 15376758 intron probably benign
IGL01769:Foxp2 APN 6 15409835 missense possibly damaging 0.92
IGL02578:Foxp2 APN 6 15376815 intron probably benign
IGL03368:Foxp2 APN 6 15394718 missense probably damaging 1.00
R0004:Foxp2 UTSW 6 15197096 missense possibly damaging 0.68
R0081:Foxp2 UTSW 6 15405644 critical splice donor site probably benign
R0095:Foxp2 UTSW 6 15196977 missense probably damaging 1.00
R0233:Foxp2 UTSW 6 15409753 missense probably damaging 1.00
R0294:Foxp2 UTSW 6 15376774 intron probably benign
R0357:Foxp2 UTSW 6 15409840 missense probably damaging 0.99
R0432:Foxp2 UTSW 6 15254279 intron probably benign
R0659:Foxp2 UTSW 6 15254279 intron probably benign
R1381:Foxp2 UTSW 6 15409766 missense possibly damaging 0.50
R1813:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R1896:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R2020:Foxp2 UTSW 6 15324644 missense possibly damaging 0.73
R2167:Foxp2 UTSW 6 15437902 missense probably damaging 1.00
R2326:Foxp2 UTSW 6 15409939 missense possibly damaging 0.84
R3829:Foxp2 UTSW 6 15379831 unclassified probably benign
R3978:Foxp2 UTSW 6 15197208 unclassified probably benign
R4393:Foxp2 UTSW 6 15377690 intron probably benign
R4703:Foxp2 UTSW 6 15411248 missense probably benign 0.03
R5202:Foxp2 UTSW 6 15394771 missense probably benign 0.05
R5303:Foxp2 UTSW 6 15324637 missense probably benign 0.00
R5368:Foxp2 UTSW 6 15377914 intron probably benign
R5533:Foxp2 UTSW 6 15197120 nonsense probably null
R5655:Foxp2 UTSW 6 15197113 missense probably damaging 0.99
R6220:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R6241:Foxp2 UTSW 6 15394762 missense probably damaging 1.00
R6365:Foxp2 UTSW 6 15286685 missense probably damaging 1.00
R6384:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R7217:Foxp2 UTSW 6 15416024 missense unknown
R7553:Foxp2 UTSW 6 15437882 missense unknown
X0023:Foxp2 UTSW 6 15409835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTGATCGTAACCTGACAG -3'
(R):5'- TCCACTGGTTTGAAGCCTTC -3'

Sequencing Primer
(F):5'- ATCGTAACCTGACAGGCGCTAG -3'
(R):5'- GTTTTTCCAGTCCACTTGTTGAAAC -3'
Posted On2014-08-25