Incidental Mutation 'R2014:Trip12'
ID 222484
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Name thyroid hormone receptor interactor 12
Synonyms Gtl6, 1110036I07Rik, 6720416K24Rik
MMRRC Submission 040023-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2014 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 84698910-84818237 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 84738587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 756 (L756*)
Ref Sequence ENSEMBL: ENSMUSP00000140267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]
AlphaFold G5E870
Predicted Effect probably null
Transcript: ENSMUST00000027421
AA Change: L756*
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: L756*

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185567
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186465
AA Change: L756*
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: L756*

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186648
AA Change: L750*
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: L750*

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186894
AA Change: L756*
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: L756*

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T G 17: 48,347,723 (GRCm39) T194P possibly damaging Het
Aadacl4fm5 A T 4: 144,506,295 (GRCm39) L132Q probably damaging Het
Acsbg2 T A 17: 57,160,855 (GRCm39) K263M possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Adgrl2 C T 3: 148,532,111 (GRCm39) G1041R probably damaging Het
Ahnak T C 19: 8,990,545 (GRCm39) I3943T probably damaging Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 (GRCm39) Q36* probably null Het
Amer3 T C 1: 34,618,525 (GRCm39) probably benign Het
Angptl8 T C 9: 21,748,358 (GRCm39) probably null Het
Ankmy1 T C 1: 92,812,863 (GRCm39) D482G probably benign Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Asb13 T G 13: 3,699,512 (GRCm39) probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Cd163 G T 6: 124,302,457 (GRCm39) W1007L probably damaging Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cp A G 3: 20,041,598 (GRCm39) K44E probably benign Het
Crtap C A 9: 114,210,653 (GRCm39) probably null Het
Ctsk A G 3: 95,414,003 (GRCm39) D250G probably damaging Het
Dcp2 T C 18: 44,543,363 (GRCm39) V307A probably benign Het
Dnah6 T A 6: 73,150,402 (GRCm39) D787V probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Espl1 C T 15: 102,231,149 (GRCm39) R17* probably null Het
Espn G T 4: 152,217,416 (GRCm39) probably null Het
Fam20b C T 1: 156,533,511 (GRCm39) R35Q possibly damaging Het
Fga A G 3: 82,940,064 (GRCm39) I573V probably damaging Het
Fmo5 A G 3: 97,542,998 (GRCm39) K103E possibly damaging Het
Frem1 A T 4: 82,924,089 (GRCm39) V291D probably damaging Het
Gabbr1 A G 17: 37,367,674 (GRCm39) probably null Het
Gjb6 T C 14: 57,362,213 (GRCm39) H16R probably damaging Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
Gulo T A 14: 66,246,496 (GRCm39) M1L probably benign Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Heatr5b T C 17: 79,121,613 (GRCm39) D704G probably damaging Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hps1 G A 19: 42,750,951 (GRCm39) P350S probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kif21b T C 1: 136,076,020 (GRCm39) F270L probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt27 A G 11: 99,240,318 (GRCm39) V200A probably benign Het
Lama3 T C 18: 12,657,778 (GRCm39) probably benign Het
Lmcd1 T C 6: 112,305,702 (GRCm39) W268R probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mamdc4 T A 2: 25,453,584 (GRCm39) D1195V probably damaging Het
Map2 T C 1: 66,455,295 (GRCm39) V1395A possibly damaging Het
Map3k20 C T 2: 72,268,604 (GRCm39) T537M probably benign Het
Mdga1 A G 17: 30,068,287 (GRCm39) S276P probably damaging Het
Mep1a T C 17: 43,808,797 (GRCm39) N85D probably benign Het
Mettl16 A G 11: 74,708,195 (GRCm39) S425G probably benign Het
Mthfd1l A G 10: 3,997,894 (GRCm39) T622A probably benign Het
Nbeal2 G A 9: 110,463,139 (GRCm39) L1309F probably benign Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Nlrc5 A G 8: 95,252,138 (GRCm39) probably benign Het
Notch3 C A 17: 32,376,974 (GRCm39) E310D probably benign Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or4p19 T C 2: 88,242,388 (GRCm39) T205A probably benign Het
Or5ak24 T A 2: 85,260,696 (GRCm39) H159L possibly damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Osbpl5 C A 7: 143,295,429 (GRCm39) C11F probably damaging Het
P4hb T C 11: 120,453,522 (GRCm39) E381G probably damaging Het
Pax4 A G 6: 28,446,209 (GRCm39) Y95H probably benign Het
Pdia3 T C 2: 121,265,301 (GRCm39) V390A probably damaging Het
Pigv A C 4: 133,390,034 (GRCm39) D49E possibly damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plxnb1 T A 9: 108,935,687 (GRCm39) probably benign Het
Polq A G 16: 36,898,728 (GRCm39) T2163A probably damaging Het
Pou5f2 T C 13: 78,173,972 (GRCm39) S305P probably benign Het
Ppm1h A T 10: 122,756,630 (GRCm39) H425L possibly damaging Het
Ppp1r13b G T 12: 111,800,222 (GRCm39) D518E probably benign Het
Prf1 A T 10: 61,139,674 (GRCm39) D544V probably benign Het
Prl3b1 T C 13: 27,431,948 (GRCm39) F158L probably benign Het
Prss41 C T 17: 24,056,464 (GRCm39) probably null Het
Prune2 T G 19: 17,097,887 (GRCm39) N1130K probably damaging Het
Ptgdr2 T C 19: 10,917,789 (GRCm39) F102S probably damaging Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rcbtb2 T C 14: 73,411,826 (GRCm39) probably benign Het
Rgs14 C A 13: 55,531,513 (GRCm39) S479* probably null Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sh2d4a A T 8: 68,783,735 (GRCm39) Q223L probably damaging Het
Slc14a2 T C 18: 78,193,601 (GRCm39) probably benign Het
Slc5a9 A C 4: 111,753,546 (GRCm39) S52A possibly damaging Het
Slc6a18 C A 13: 73,823,844 (GRCm39) V99L probably benign Het
Smarca2 T C 19: 26,661,305 (GRCm39) S967P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Tcte1 A T 17: 45,852,237 (GRCm39) N490I probably benign Het
Tet3 T C 6: 83,363,057 (GRCm39) E705G probably damaging Het
Tfeb T A 17: 48,102,484 (GRCm39) H450Q probably damaging Het
Tmem248 G A 5: 130,260,653 (GRCm39) E73K probably damaging Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsc1 A T 2: 28,555,649 (GRCm39) probably benign Het
Tspear G A 10: 77,710,954 (GRCm39) probably benign Het
Ttc6 T C 12: 57,623,003 (GRCm39) I134T possibly damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Usp36 T C 11: 118,153,334 (GRCm39) probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vps13d A G 4: 144,835,078 (GRCm39) S2757P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdr33 T C 18: 31,966,652 (GRCm39) V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 (GRCm39) Y269C possibly damaging Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84,708,262 (GRCm39) missense probably damaging 1.00
IGL00430:Trip12 APN 1 84,741,582 (GRCm39) missense probably damaging 0.96
IGL00465:Trip12 APN 1 84,741,582 (GRCm39) missense probably damaging 0.96
IGL00819:Trip12 APN 1 84,731,993 (GRCm39) missense probably damaging 1.00
IGL00900:Trip12 APN 1 84,702,485 (GRCm39) missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84,729,605 (GRCm39) missense probably damaging 0.99
IGL01087:Trip12 APN 1 84,735,580 (GRCm39) missense probably damaging 0.99
IGL01400:Trip12 APN 1 84,729,699 (GRCm39) missense probably damaging 0.99
IGL01521:Trip12 APN 1 84,743,919 (GRCm39) splice site probably benign
IGL01619:Trip12 APN 1 84,792,631 (GRCm39) missense probably damaging 0.99
IGL01796:Trip12 APN 1 84,705,999 (GRCm39) missense probably benign 0.42
IGL01975:Trip12 APN 1 84,792,534 (GRCm39) splice site probably benign
IGL02190:Trip12 APN 1 84,743,791 (GRCm39) missense probably damaging 0.98
IGL02474:Trip12 APN 1 84,771,854 (GRCm39) missense probably benign
IGL02517:Trip12 APN 1 84,721,535 (GRCm39) unclassified probably benign
IGL02631:Trip12 APN 1 84,743,729 (GRCm39) missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84,716,536 (GRCm39) missense probably damaging 1.00
IGL03161:Trip12 APN 1 84,738,853 (GRCm39) unclassified probably benign
IGL03388:Trip12 APN 1 84,720,907 (GRCm39) missense probably damaging 0.99
cardamom UTSW 1 84,726,997 (GRCm39) missense probably damaging 0.99
pungent UTSW 1 84,771,636 (GRCm39) missense possibly damaging 0.70
spices UTSW 1 84,771,596 (GRCm39) missense probably benign 0.10
sulfuric UTSW 1 84,736,771 (GRCm39) missense probably benign 0.19
Turmeric UTSW 1 84,732,064 (GRCm39) missense probably benign 0.07
LCD18:Trip12 UTSW 1 84,754,482 (GRCm38) unclassified probably benign
R0090:Trip12 UTSW 1 84,709,857 (GRCm39) splice site probably benign
R0111:Trip12 UTSW 1 84,736,854 (GRCm39) unclassified probably benign
R0471:Trip12 UTSW 1 84,703,928 (GRCm39) missense probably damaging 1.00
R0486:Trip12 UTSW 1 84,738,805 (GRCm39) nonsense probably null
R0557:Trip12 UTSW 1 84,702,468 (GRCm39) missense probably damaging 1.00
R0570:Trip12 UTSW 1 84,729,269 (GRCm39) missense probably damaging 1.00
R0614:Trip12 UTSW 1 84,735,482 (GRCm39) missense probably damaging 1.00
R0627:Trip12 UTSW 1 84,746,318 (GRCm39) missense probably damaging 1.00
R0630:Trip12 UTSW 1 84,771,636 (GRCm39) missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84,736,771 (GRCm39) missense probably benign 0.19
R0741:Trip12 UTSW 1 84,722,902 (GRCm39) missense probably benign 0.09
R0862:Trip12 UTSW 1 84,721,730 (GRCm39) missense probably damaging 0.99
R0864:Trip12 UTSW 1 84,721,730 (GRCm39) missense probably damaging 0.99
R1124:Trip12 UTSW 1 84,714,758 (GRCm39) missense probably damaging 1.00
R1252:Trip12 UTSW 1 84,754,071 (GRCm39) nonsense probably null
R1455:Trip12 UTSW 1 84,736,821 (GRCm39) missense probably benign 0.01
R1487:Trip12 UTSW 1 84,746,352 (GRCm39) missense probably damaging 1.00
R1702:Trip12 UTSW 1 84,722,784 (GRCm39) missense probably damaging 1.00
R1781:Trip12 UTSW 1 84,708,342 (GRCm39) missense probably benign 0.01
R1847:Trip12 UTSW 1 84,726,990 (GRCm39) missense probably damaging 1.00
R1854:Trip12 UTSW 1 84,705,866 (GRCm39) missense probably damaging 1.00
R1866:Trip12 UTSW 1 84,722,781 (GRCm39) missense probably damaging 1.00
R1926:Trip12 UTSW 1 84,727,012 (GRCm39) missense probably damaging 0.98
R1935:Trip12 UTSW 1 84,771,822 (GRCm39) missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84,738,522 (GRCm39) missense probably damaging 1.00
R1994:Trip12 UTSW 1 84,726,893 (GRCm39) missense probably damaging 1.00
R2391:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R2423:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R2433:Trip12 UTSW 1 84,721,544 (GRCm39) missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84,732,064 (GRCm39) missense probably benign 0.07
R3040:Trip12 UTSW 1 84,719,966 (GRCm39) missense probably benign 0.13
R3735:Trip12 UTSW 1 84,792,511 (GRCm39) frame shift probably null
R3907:Trip12 UTSW 1 84,709,827 (GRCm39) missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84,703,462 (GRCm39) missense probably damaging 1.00
R4540:Trip12 UTSW 1 84,726,997 (GRCm39) missense probably damaging 0.99
R4859:Trip12 UTSW 1 84,771,531 (GRCm39) missense probably damaging 0.99
R5240:Trip12 UTSW 1 84,771,854 (GRCm39) missense probably benign
R5278:Trip12 UTSW 1 84,739,868 (GRCm39) missense probably damaging 1.00
R5377:Trip12 UTSW 1 84,735,152 (GRCm39) missense probably damaging 1.00
R5510:Trip12 UTSW 1 84,746,401 (GRCm39) missense probably damaging 1.00
R5542:Trip12 UTSW 1 84,727,065 (GRCm39) missense probably damaging 1.00
R5550:Trip12 UTSW 1 84,738,820 (GRCm39) missense probably damaging 0.99
R5886:Trip12 UTSW 1 84,708,179 (GRCm39) intron probably benign
R5893:Trip12 UTSW 1 84,736,884 (GRCm39) unclassified probably benign
R5914:Trip12 UTSW 1 84,741,179 (GRCm39) missense probably damaging 1.00
R5925:Trip12 UTSW 1 84,726,974 (GRCm39) nonsense probably null
R5985:Trip12 UTSW 1 84,703,492 (GRCm39) missense probably damaging 0.99
R6135:Trip12 UTSW 1 84,738,559 (GRCm39) missense probably benign 0.00
R6158:Trip12 UTSW 1 84,738,733 (GRCm39) missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84,771,591 (GRCm39) missense probably damaging 1.00
R6816:Trip12 UTSW 1 84,771,435 (GRCm39) missense probably damaging 0.99
R7144:Trip12 UTSW 1 84,771,435 (GRCm39) missense probably damaging 0.99
R7194:Trip12 UTSW 1 84,771,943 (GRCm39) missense probably benign 0.07
R7355:Trip12 UTSW 1 84,792,604 (GRCm39) missense probably damaging 1.00
R7361:Trip12 UTSW 1 84,728,163 (GRCm39) missense probably damaging 0.98
R7588:Trip12 UTSW 1 84,738,604 (GRCm39) missense probably damaging 0.99
R7705:Trip12 UTSW 1 84,755,170 (GRCm39) missense probably damaging 1.00
R7818:Trip12 UTSW 1 84,738,527 (GRCm39) missense probably damaging 1.00
R7918:Trip12 UTSW 1 84,722,784 (GRCm39) missense probably damaging 0.98
R8127:Trip12 UTSW 1 84,716,463 (GRCm39) missense probably damaging 0.99
R8221:Trip12 UTSW 1 84,743,771 (GRCm39) missense possibly damaging 0.80
R8336:Trip12 UTSW 1 84,743,762 (GRCm39) missense probably benign 0.37
R8373:Trip12 UTSW 1 84,773,488 (GRCm39) missense probably damaging 0.98
R8719:Trip12 UTSW 1 84,722,790 (GRCm39) missense probably damaging 0.98
R8771:Trip12 UTSW 1 84,721,018 (GRCm39) unclassified probably benign
R8997:Trip12 UTSW 1 84,771,596 (GRCm39) missense probably benign 0.10
R9146:Trip12 UTSW 1 84,771,881 (GRCm39) missense possibly damaging 0.89
R9236:Trip12 UTSW 1 84,703,550 (GRCm39) missense probably damaging 1.00
R9338:Trip12 UTSW 1 84,727,019 (GRCm39) missense probably damaging 0.99
R9391:Trip12 UTSW 1 84,773,473 (GRCm39) missense probably benign 0.00
R9516:Trip12 UTSW 1 84,735,215 (GRCm39) missense probably damaging 1.00
X0023:Trip12 UTSW 1 84,738,508 (GRCm39) missense probably benign 0.12
X0065:Trip12 UTSW 1 84,726,884 (GRCm39) missense probably benign 0.21
Z1088:Trip12 UTSW 1 84,743,889 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCTTCTTTCTCAGGAGAC -3'
(R):5'- TCCACGAAGTCCTCAAGAGC -3'

Sequencing Primer
(F):5'- GACCTTCTTTCTCAGGAGACAAAATG -3'
(R):5'- CACGAAGTCCTCAAGAGCTGTATG -3'
Genotyping

NOTE: These primers have not been validated.

R2014:Trip12 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

R20140003(F): 5’- AGGACCTTCTTTCTCAGGAGAC-3’

R20140003(R): 5’- TCCACGAAGTCCTCAAGAGC-3’

Sequencing Primers

R20140003_seq(F): 5’- GACCTTCTTTCTCAGGAGACAAAATG-3’
 

R20140003_seq(R): 5’- CACGAAGTCCTCAAGAGCTGTATG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 447 nucleotides is amplified (Chr.1: 84760609-84761055, GRCm38; NCBI RefSeq: NC_000067):

aggaccttct ttctcaggag acaaaatgag agaatcttga gttaattcaa aactgagcac       

acttaaacac acacaaccac ctccccattt gccatcccta cacccactct ccacaaaaat      

aagacatatt taaacggtac aatgaaacta ctacctcaat gatccggctg tcaatcctgt      

tatagggatg ccagaggcct cggtcatccc gccactgcca tattgcacca tctgtgttct      

gtgcatttcc ctttttcaac atggtatcaa ctgcgaagat gccttctttt ggtaaacatg      

gcataagttc actgaaagta aaacgtgcaa ttattttagt aactttctgc accatctgta      

actgtcaatt aaaattttca aggacaatca acccattttt accaaatcaa agatgtcagc      

tcatacagct cttgaggact tcgtgga

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr.+ strand, A>T; sense strand, T>A).

Posted On 2014-08-25